From Fri Mar 10 07:57:44 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 10 Mar 2000 15:57:55 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 15933 invoked from network); 10 Mar 2000 15:57:04 -0000 Received: from ml.egroups.com (10.1.1.31) by iqg.egroups.com with SMTP; 10 Mar 2000 15:57:04 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.6] by ml.egroups.com with NNFMP; 10 Mar 2000 15:57:03 -0000 Date: Fri, 10 Mar 2000 07:56:58 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8ab60a$ctre@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Genesis MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Hello there. I thought an introductory wave might be in order; a reciprocal one from anyone who joins this list, with small introduction as to who they think they are, would be as good a way as any to get the ball rolling, I suppose. I'm Kevan, anyway, the Speaker of this thing, and a twenty-something software engineer and Webmaster from Brighton, England. You might remember me from Thring, Garden Nomic, Mornington Nomic and the Paranomics, but then again, you might not. Still, if you've got any questions about what we're doing here or why we're bothering, or simply wish to announce your arrival and immediate readiness to wade in, speak up. Hopefully we can get this thing up and running before too long; I'd guess about four or five people is the minimum necessary to make it worth the candle - we'll see how things go. Kevan -- kevan@s... http://www.stormloader.com/kevan From <_egroups@r...> Fri Mar 10 08:32:41 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 10 Mar 2000 16:32:52 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 10667 invoked from network); 10 Mar 2000 16:32:33 -0000 Received: from ef.egroups.com (10.1.2.111) by iqh.egroups.com with SMTP; 10 Mar 2000 16:32:33 -0000 X-eGroups-Return: _egroups@r... Received: from [10.1.2.129] by ef.egroups.com with NNFMP; 10 Mar 2000 16:32:32 -0000 Date: Fri, 10 Mar 2000 08:32:22 -0800 From: "Raven Black" <_egroups@r...> To: genomic@e... Message-ID: <8ab82m$t6i@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Intro MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit In a break from my usual dismissal of such things, it seems I'm actually the first to join up for this. Greetings, I'm RavenBlack, you may remember me from no other Nomics at all... Except Paranomic for a while. It seems a waste of time to introduce myself here rather than simply point at http://www.ravenblack.net/ So I'll do it that way. Done. --RavenBlack From Sat Mar 11 09:40:10 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 11 Mar 2000 17:40:20 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 14414 invoked from network); 11 Mar 2000 17:39:35 -0000 Received: from f230.law8.hotmail.com (HELO hotmail.com) (216.33.241.230) by mx3.egroups.com with SMTP; 11 Mar 2000 17:39:35 -0000 Received: (qmail 61418 invoked by uid 0); 11 Mar 2000 17:39:35 -0000 Message-ID: <20000311173935.61417.qmail@h...> Received: from 204.60.28.175 by www.hotmail.com with HTTP; Sat, 11 Mar 2000 09:39:35 PST X-Originating-IP: [204.60.28.175] From: "Tyrethali Ansrath" To: genomic@e... Date: Sat, 11 Mar 2000 12:39:35 EST Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Intro Too MIME-Version: 1.0 Content-Type: text/plain; format=flowed Content-Transfer-Encoding: 7bit Hi, I just joined. I'm Tyrethali, and you're more likely to remember me from Polynomic, Ackanomic, or Paranomic, since when I was in Garden Nomic and Omeganomic I went by the handle "Brex". As for my non-nomic related hobbies, well, there are RPGs [and recently, Interactive Fiction], ConLangs, and ALife. And surely a few others, but those three and nomic dominate the bookmark file, at least. And for the record, I think 3 players is just fine for a nomic, at least initially. I've played a few 3-player over chat, and more than a few 2-player ones... ______________________________________________________ From Sun Mar 12 04:12:11 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 12 Mar 2000 12:12:22 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 14176 invoked from network); 12 Mar 2000 12:12:08 -0000 Received: from ck.egroups.com (10.1.2.83) by iqg.egroups.com with SMTP; 12 Mar 2000 12:12:08 -0000 X-eGroups-Return: zanangel@i... Received: from [10.1.2.128] by ck.egroups.com with NNFMP; 12 Mar 2000 12:12:06 -0000 Date: Sun, 12 Mar 2000 04:12:02 -0800 From: "Chrissy" To: genomic@e... Message-ID: <8ag1ii$s5g1@e...> In-Reply-To: <20000311173935.61417.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Intro Too MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > As for my non-nomic related hobbies, well, there are RPGs [and recently, > Interactive Fiction], ConLangs, and ALife. ALife? Splendid. I've a few Proposal ideas somewhere in that area, as befits the name of the Nomic... > And for the record, I think 3 players is just fine for a nomic, at least > initially. I've played a few 3-player over chat, and more than a few > 2-player ones... True enough; I've played quite a number of two-player ones in my time, and they've all worked out quite reasonably. It'd be nice to have a few more players so that there was a decent spread of "initial theme" ideas, but there's no reason why such couldn't turn up a few weeks in and overwrite the old ones. No objections if I declare Week One's commencement for 1pm tomorrow, then? Kevan -- kevan@s... http://www.stormloader.com/kevan From Sun Mar 12 04:16:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 12 Mar 2000 12:16:25 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 30376 invoked from network); 12 Mar 2000 12:16:07 -0000 Received: from ck.egroups.com (10.1.2.83) by iqh.egroups.com with SMTP; 12 Mar 2000 12:16:07 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.5] by ck.egroups.com with NNFMP; 12 Mar 2000 12:16:05 -0000 Date: Sun, 12 Mar 2000 04:16:01 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8ag1q1$g5jv@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Not Chrissy MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Tsk, I keep overlooking the fact that she's logged in to eGroups as herself, when I use her computer. Hopeless. Kevan -- kevan@s... http://www.stormloader.com/kevan From Sun Mar 12 11:27:02 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 12 Mar 2000 19:27:12 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22860 invoked from network); 12 Mar 2000 19:26:49 -0000 Received: from ef.egroups.com (10.1.2.111) by iqh.egroups.com with SMTP; 12 Mar 2000 19:26:49 -0000 X-eGroups-Return: mctupper@h... Received: from [10.1.2.130] by ef.egroups.com with NNFMP; 12 Mar 2000 19:26:47 -0000 Date: Sun, 12 Mar 2000 11:26:42 -0800 From: "Xylen" To: genomic@e... Message-ID: <8agr1i$glss@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Intro MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Hi all, After checking all of my nomics, and only finding one of them officially alive, I stumbled across this one. I really enjoy starting up a game. Maybe someday one of my nomics will stick around for awhile so I can find out what it's like to be an elder. I've played in Beserker Nomic, Common-Law-Nomic, Three-Rivers Nomic, Acka-Lite, and Fantasy Rules Committee. FRC is currently the only one still alive. The one thing that seems to kill off most starting nomics is the complexity of the rules. I like the fact that you are staring with a very simple and common sense approach. That allows the players to indulge in thier own creativity. This is essential to give the new nomic a head start on a long life. The other killer is usually the record keeping that takes up more and more time. As long as the head-poohbah-of-publications can keep up with everything, the game will proceed. Two of my other nomics died when the record keeper lost access or the will to manage the records. On the other hand, FRC thrives because most of the rules are repealed every few weeks, and a new game commences, all according to the core set of rules. Well, that is enough blathering for now. I hope that things can get started soon. With one more player, it makes things a bit more interesting. Xylen From Sun Mar 12 17:31:08 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 13 Mar 2000 01:31:19 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 26768 invoked from network); 13 Mar 2000 01:31:16 -0000 Received: from mw.egroups.com (10.1.2.2) by iqg.egroups.com with SMTP; 13 Mar 2000 01:31:16 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.131] by mw.egroups.com with NNFMP; 13 Mar 2000 01:31:12 -0000 Date: Sun, 12 Mar 2000 17:31:10 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8ahgcu$43fj@e...> In-Reply-To: <8ab60a$ctre@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Genesis MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Greetings - Against my better judgement, I've decided to join this Nomic. When I first discovered the entire Nomic concept, my internet wanderings eventually lead me to the Garden Nomic, where Kevan was kind enough to show me the ropes. My real passion in life is a place called the Live Games Forum at Delphi (www.delphi.com/livegames). We play several different text based games there nightly in the chat rooms, and several other message board oriented games. I schedule the nightly games and host several of them. Some of the discussions concerning the rules of these simplistic message board games started reaching truly Nomic-like proportions, and this observation inspired me to start McNomic on the message boards there, and Kevan has been a very active player in that game. While the game is currently only in its 4th cycle (we prefer "relaxed pace" to "sluggish"), the Ruleset has at least tripled in length in very new and interesting ways, and the crowd of largely Nomic Virgins playing there seem to have taken to the game surprisingly well. My Duties in LGF (and my real-life work as a Senior Software Designer/Analyst) keeps me very busy, so I have some doubts about exactly how active I will be in this game, but the birth of a new Nomic is a very unique kind of fun, and since its one of Kevan's, I could not resist. I look forward to playing with you all. Should Kevan accept my registration, I'll be the player named "Mac". - Mac www.xnet.com/~dmckenna From Mon Mar 13 04:46:31 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 13 Mar 2000 12:46:42 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 23188 invoked from network); 13 Mar 2000 12:45:53 -0000 Received: from fg.egroups.com (10.1.2.134) by iqg.egroups.com with SMTP; 13 Mar 2000 12:45:53 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.123] by fg.egroups.com with NNFMP; 13 Mar 2000 12:45:52 -0000 Date: Mon, 13 Mar 2000 04:45:44 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8ainto$qndb@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] what subject? MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Morning, all. This is my first time. Be gentle :) From Mon Mar 13 05:14:20 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 13 Mar 2000 13:14:31 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 10051 invoked from network); 13 Mar 2000 13:14:16 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 13 Mar 2000 13:14:16 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.131] by mv.egroups.com with NNFMP; 13 Mar 2000 13:14:16 -0000 Date: Mon, 13 Mar 2000 05:14:14 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8aipj6$4dtj@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week One Begins MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Week One has begun. From now until 1pm on the 20th of March, any of you lot who have signed up (me, Raven, Tyrethali, Xylen, Mac and The Twisted One, so far) can submit Proposals to me via private email. At 1pm on the 20th, Week One will end, and I'll scuttle off to do the stuff for Interregnum One (basically just put all your Proposals in one big file and distribute it via the mailing list). When that's done, Week Two will begin, during which you can submit more Proposals, and - more importantly - vote on the ones that have been distributed. I think that's everything. Off you go. Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 13 05:42:29 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 13 Mar 2000 13:42:41 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 29305 invoked from network); 13 Mar 2000 13:35:37 -0000 Received: from oe4.law7.hotmail.com (HELO hotmail.com) (216.33.236.108) by mx3.egroups.com with SMTP; 13 Mar 2000 13:35:37 -0000 Received: (qmail 55551 invoked by uid 65534); 13 Mar 2000 13:35:37 -0000 Message-ID: <20000313133537.55550.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8ainto$qndb@e...> Date: Mon, 13 Mar 2000 13:34:13 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] whither neomancy? MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_000E_01BF8CF0.D24462C0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_000E_01BF8CF0.D24462C0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable This is my first time, also... so I'm just going to sit on the sidelines an= d shout encouragement (very quietly) Unless anyone has objections to this? DjA ------=_NextPart_000_000E_01BF8CF0.D24462C0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
This is my first time, also... so I'm just going to sit= on the = sidelines and shout encouragement (very quietly)
 
Unless anyone has objections to this?
 
DjA
------=_NextPart_000_000E_01BF8CF0.D24462C0-- From Wed Mar 15 15:46:57 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 15 Mar 2000 23:47:10 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 14347 invoked from network); 15 Mar 2000 23:47:09 -0000 Received: from cj.egroups.com (10.1.2.82) by iqh.egroups.com with SMTP; 15 Mar 2000 23:47:09 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.123] by cj.egroups.com with NNFMP; 15 Mar 2000 23:47:06 -0000 Date: Wed, 15 Mar 2000 15:47:03 -0800 From: "M Schuler" To: genomic@e... Message-ID: <8ap7dn$ijjf@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] introductions MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Greetings All! Allow me to introduce myself as Oloros, a composer of chamber music, sometime-vegetarian, and nomic-virgin. I expect more of myself will become evident as we cross swords in the next few months. From Wed Mar 15 21:56:02 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 05:56:15 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 15222 invoked from network); 16 Mar 2000 05:56:14 -0000 Received: from c9.egroups.com (10.1.2.66) by iqg.egroups.com with SMTP; 16 Mar 2000 05:56:14 -0000 X-eGroups-Return: stanleyk@s... Received: from [10.1.2.26] by c9.egroups.com with NNFMP; 16 Mar 2000 05:56:14 -0000 Date: Wed, 15 Mar 2000 21:56:06 -0800 From: "Stanley Kubrick" To: genomic@e... Message-ID: <8apt1m$5dr3@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit On the assumption that Kevan doesn't find something horribly deterring in my e-mail to him, I think that I'm joining Genomic. A bit about me, then: My name is Josh Millard, I'm a 20ish CS major at Worcester Polytechnic Institute (home of the net.flame and gweeping) in Massachusetts, USofA. I have too many hobbies, an over-abundance of interests, and a steaming pile of distractions, and I'm entirely too happy to add this game to that list. I'm a musician in the vaporous category that falls between garage bands with no hope and folks who actually play out and make money and get famous and get hooked on heroin et al. Not sure how I feel about that, though. I'm also a complete Nomic virgin, and a hardcore (AndProudOfIt) geek. Hi. From Thu Mar 16 01:30:41 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 09:30:55 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8101 invoked from network); 16 Mar 2000 09:30:53 -0000 Received: from ef.egroups.com (10.1.2.111) by iqh.egroups.com with SMTP; 16 Mar 2000 09:30:53 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.131] by ef.egroups.com with NNFMP; 16 Mar 2000 09:30:53 -0000 Date: Thu, 16 Mar 2000 01:30:45 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8aq9k5$ku3j@e...> In-Reply-To: <8apt1m$5dr3@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > On the assumption that Kevan doesn't find something horribly deterring > in my e-mail to him... Actually Kevan doesn't even find the email to him. Unless you're trying to confuse me by sending a sign-up email under the nom de guerre of "Pulp" or "Gallivanting Tripper", and posting to the mailing list with a completely different name and address, or something. Kevan -- kevan@s... http://www.stormloader.com/kevan From Thu Mar 16 01:38:48 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 09:39:01 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13118 invoked from network); 16 Mar 2000 09:38:58 -0000 Received: from oe38.law7.hotmail.com (HELO hotmail.com) (216.33.236.33) by mx3.egroups.com with SMTP; 16 Mar 2000 09:38:58 -0000 Received: (qmail 3870 invoked by uid 65534); 16 Mar 2000 09:38:58 -0000 Message-ID: <20000316093858.3869.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8aq9k5$ku3j@e...> Date: Thu, 16 Mar 2000 09:36:35 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0020_01BF8F2B.1EAC7E90" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0020_01BF8F2B.1EAC7E90 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Doesn't "Nom de geurre" tranlate directly to "Name of the Warrior" ? (I say= this because the instructions to Gauntlet had "The Warrior" as "La Guerre"= Or possibly "Le Guerre" > On the assumption that Kevan doesn't find something horribly deterring > in my e-mail to him... Actually Kevan doesn't even find the email to him. Unless you're trying to confuse me by sending a sign-up email under the nom de guerre of "Pulp" or "Gallivanting Tripper", and posting to the mailing list with a completely different name and address, or something. Kevan -- kevan@s... http://www.stormloader.com/kevan ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0020_01BF8F2B.1EAC7E90 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Doesn't "Nom de geurre" tranlate directly to "Name of t= he = Warrior" ? (I say this because the instructions to Gauntlet had "The Warrio= r" as = "La Guerre" Or possibly "Le Guerre"
 

> On the assumption that Kevan doesn't find something = horribly deterring
> in my e-mail to him...

Actually Kevan = doesn't even find the email to him. Unless you're trying
to confuse me= by = sending a sign-up email under the nom de guerre of
"Pulp" or "Gallivan= ting = Tripper", and posting to the mailing list with
a completely different = name = and address, or something.

Kevan

--
kevan@s...=
http://www.stormloader.com/keva= n

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0020_01BF8F2B.1EAC7E90-- From Thu Mar 16 02:37:55 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 10:38:08 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 16781 invoked from network); 16 Mar 2000 10:38:06 -0000 Received: from c9.egroups.com (10.1.2.66) by iqg.egroups.com with SMTP; 16 Mar 2000 10:38:06 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.15] by c9.egroups.com with NNFMP; 16 Mar 2000 10:38:06 -0000 Date: Thu, 16 Mar 2000 02:37:58 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8aqdi6$76op@e...> In-Reply-To: <20000316093858.3869.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Doesn't "Nom de geurre" tranlate directly to "Name of the Warrior" ? "War name", I think. A fictitious name assumed for a short amount of time. Kevan -- kevan@s... http://www.stormloader.com/kevan From Thu Mar 16 03:00:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 11:00:27 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 21635 invoked from network); 16 Mar 2000 11:00:24 -0000 Received: from oe9.law7.hotmail.com (HELO hotmail.com) (216.33.236.113) by mx3.egroups.com with SMTP; 16 Mar 2000 11:00:24 -0000 Received: (qmail 58893 invoked by uid 65534); 16 Mar 2000 11:00:24 -0000 Message-ID: <20000316110024.58892.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8aqdi6$76op@e...> Date: Thu, 16 Mar 2000 10:59:05 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0011_01BF8F36.A597FAF0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0011_01BF8F36.A597FAF0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Whereas a 'Nom de Plume' (Name of the Pen? I know someone who used to name = their pens....) is for a longer period of time? I worry about the French, sometimes... ----- Original Message ----- = From: Kevan Davis = To: genomic@e... = Sent: Thursday, March 16, 2000 10:37 AM Subject: [genomic] Re: (stumbling blithely into the room) > Doesn't "Nom de geurre" tranlate directly to "Name of the Warrior" ? "War name", I think. A fictitious name assumed for a short amount of time. Kevan -- kevan@s... http://www.stormloader.com/kevan ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0011_01BF8F36.A597FAF0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Whereas a 'Nom de Plume' (Name of the Pen? I know someo= ne who = used to name their pens....) is for a longer period of time?
 
 
I worry about the French, sometimes...
----- Original Message -----
Fro= m: = Kevan Davis
Sent: Thursday, March 16, 2000 10:= 37 = AM
Subject: [genomic] Re: (stumbling = blithely into the room)

> Doesn't "Nom de geurre" tranlate directly to "Name of= the = Warrior" ?

"War name", I think. A fictitious name assumed for a sh= ort = amount of
time.

Kevan

--
kevan@s...=
http://www.stormloader.com/keva= n

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0011_01BF8F36.A597FAF0-- From RavenBlack Thu Mar 16 06:32:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 14:32:27 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13382 invoked from network); 16 Mar 2000 14:32:25 -0000 Received: from smtp01.mrf.mail.rcn.net (207.172.4.60) by qh.egroups.com with SMTP; 16 Mar 2000 14:32:25 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp01.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12VbJf-0005p0-00 for genomic@egroups.com; Thu, 16 Mar 2000 09:31:59 -0500 Message-Id: <3.0.2.32.20000316093339.0307e904@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Thu, 16 Mar 2000 09:33:39 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <20000316110024.58892.qmail@h...> References: <8aqdi6$76op@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >Whereas a 'Nom de Plume' (Name of the Pen? I know someone >who used to name their pens....) is for a longer period of time? Well, the pen /is/ mightier than the sword. I'm not certain in what context. Perhaps "ink consumption". --RavenBlack From Thu Mar 16 06:47:09 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 14:47:22 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 15937 invoked from network); 16 Mar 2000 14:47:19 -0000 Received: from oe8.law7.hotmail.com (HELO hotmail.com) (216.33.236.112) by mx3.egroups.com with SMTP; 16 Mar 2000 14:47:19 -0000 Received: (qmail 10007 invoked by uid 65534); 16 Mar 2000 14:47:18 -0000 Message-ID: <20000316144718.10006.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8aqdi6$76op@e...> <3.0.2.32.20000316093339.0307e904@w...> Date: Thu, 16 Mar 2000 14:43:17 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: (stumbling blithely into the room) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0016_01BF8F55.F7653360" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0016_01BF8F55.F7653360 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable "As long as the sword is very short and the pen is very sharp" >Whereas a 'Nom de Plume' (Name of the Pen? I know someone = >who used to name their pens....) is for a longer period of time? Well, the pen /is/ mightier than the sword. I'm not certain in what context. Perhaps "ink consumption". --RavenBlack ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0016_01BF8F55.F7653360 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
"As long as the sword is very short and the pen is very= = sharp"
 
>Whereas = a 'Nom de Plume' (Name of the Pen? I know someone
>who used to nam= e = their pens....) is for a longer period of time?
Well, the pen /is/ mig= htier = than the sword.
I'm not certain in what context. Perhaps "ink = consumption".

--RavenBlack

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0016_01BF8F55.F7653360-- From Thu Mar 16 06:47:55 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 14:48:08 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 29808 invoked from network); 16 Mar 2000 14:48:06 -0000 Received: from imk.egroups.com (HELO mk.egroups.com) (10.1.1.30) by iqh.egroups.com with SMTP; 16 Mar 2000 14:48:06 -0000 X-eGroups-Return: pswanson@m... Received: from [10.1.2.130] by mk.egroups.com with NNFMP; 16 Mar 2000 14:48:05 -0000 Date: Thu, 16 Mar 2000 06:47:58 -0800 From: "paul" To: genomic@e... Message-ID: <8aqs6u$36lk@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] i love to join your game MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit hey, i've never actually played nomic but i've known about it for awhile and always wanted to play. i feel lucky to have stumbled across this nomic in the middle of its first turn; hopefully Kevan will accept my application (and maybe kind enough to accept some Proposals before the first Week is up). you all seem like a bunch of cool cats. about me, i'm an unemployed but recovering microsoftie in the seattle area. my days are spent watching NewsRadio reruns, playing spades and tetris attack, and maybe becoming a game designer (card or board, for now). i look forward to an entertaining first game; i told Kevan that i would like to be called "microstoned", my nickname on the Zone that i've also adopted elsewhere. either that or i guess "paul" is fine. paul From Thu Mar 16 07:27:37 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 15:27:51 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 3605 invoked from network); 16 Mar 2000 15:27:49 -0000 Received: from b05.egroups.com (10.1.2.184) by iqh.egroups.com with SMTP; 16 Mar 2000 15:27:49 -0000 X-eGroups-Return: stanleyk@s... Received: from [10.1.2.129] by b05.egroups.com with NNFMP; 16 Mar 2000 15:26:48 -0000 Date: Thu, 16 Mar 2000 07:24:41 -0800 From: "Stanley Kubrick" To: genomic@e... Message-ID: <8aqubp$bv66@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] No Subject MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit >> On the assumption that Kevan doesn't find something horribly deterring >> in my e-mail to him... >Actually Kevan doesn't even find the email to him. Unless you're trying >to confuse me by sending a sign-up email under the nom de guerre of >"Pulp" or "Gallivanting Tripper", and posting to the mailing list with >a completely different name and address, or something. Faux pas! Thusly have I exhausted my knowledge of the French language. Or something. Anyway, sorry about not being more explicit in my e-mail; I am commonly known as Pulp. I suppose that is just as acceptable as Josh in the game, though I might develop strong bifurcated personality symptoms if people use both. :) Sorry for the confusion. Josh From RavenBlack Thu Mar 16 07:57:38 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 15:57:51 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 5127 invoked from network); 16 Mar 2000 15:57:49 -0000 Received: from smtp01.mrf.mail.rcn.net (207.172.4.60) by qh.egroups.com with SMTP; 16 Mar 2000 15:57:49 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp01.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12VceI-0000sy-00 for genomic@e...; Thu, 16 Mar 2000 10:57:22 -0500 Message-Id: <3.0.2.32.20000316105905.0308006c@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Thu, 16 Mar 2000 10:59:05 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8aqubp$bv66@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: No Subject MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >Anyway, sorry about not being more explicit in my e-mail; I am >commonly known as Pulp. I suppose that is just as acceptable >as Josh in the game, though I might develop strong bifurcated >personality symptoms if people use both. :) May I request that you attempt to settle on one (or less) of "Josh", "Pulp" and "Stanley Kubrick"? Choosing to use a name that matches your email settings would be convenient for those of us reading such things. Demanding, --RavenBlack From Pulp Thu Mar 16 09:03:44 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 17:03:58 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 12759 invoked from network); 16 Mar 2000 17:03:49 -0000 Received: from smtp.wpi.edu (130.215.24.62) by qh.egroups.com with SMTP; 16 Mar 2000 17:03:49 -0000 Received: from grover.WPI.EDU (root@g... [130.215.25.67]) by smtp.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2GH3mA02017 for ; Thu, 16 Mar 2000 12:03:48 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by grover.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2GH3mD09863 for ; Thu, 16 Mar 2000 12:03:48 -0500 (EST) Date: Thu, 16 Mar 2000 12:03:47 -0500 (EST) From: Pulp To: genomic@e... In-Reply-To: <3.0.2.32.20000316105905.0308006c@w...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: No Subject MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > May I request that you attempt to settle on one (or less) of > "Josh", "Pulp" and "Stanley Kubrick"? Choosing to use a name > that matches your email settings would be convenient for those > of us reading such things. Fair enough. To start anew: Hi, I'm Pulp. Glad to be here. Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From Thu Mar 16 09:24:39 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 17:24:53 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 62 invoked from network); 16 Mar 2000 17:24:51 -0000 Received: from oe9.law7.hotmail.com (HELO hotmail.com) (216.33.236.113) by qg.egroups.com with SMTP; 16 Mar 2000 17:24:51 -0000 Received: (qmail 63160 invoked by uid 65534); 16 Mar 2000 17:24:51 -0000 Message-ID: <20000316172451.63159.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: Date: Thu, 16 Mar 2000 17:22:26 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: No Subject MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0028_01BF8F6C.332054A0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0028_01BF8F6C.332054A0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Fair enough. To start anew: Hi, I'm Pulp. Glad to be here. Joshua Millard =3D=3D pulp@w... && www.wpi.edu/~pulp *chuckles* "Hi, I'm Pulp, signed, Joshua" I'll get me coat.... ------=_NextPart_000_0028_01BF8F6C.332054A0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
Fair enough. To start anew:

Hi, I'm Pulp. Glad to be here.

Joshua Millard =3D=3D pulp@w... &=
;& www.wpi.edu/~pulp

*chuckles*
 
"Hi, I'm Pulp, signed,=
Joshua"
 
I'll get me coat....
 ------=_NextPart_000_0028_01BF8F6C.332054A0-- From Pulp Thu Mar 16 09:33:24 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 17:33:38 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 26399 invoked from network); 16 Mar 2000 17:33:33 -0000 Received: from smtp.wpi.edu (130.215.24.62) by mx3.egroups.com with SMTP; 16 Mar 2000 17:33:33 -0000 Received: from grover.WPI.EDU (root@g... [130.215.25.67]) by smtp.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2GHXWA18950 for ; Thu, 16 Mar 2000 12:33:32 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by grover.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2GHXVD26486 for ; Thu, 16 Mar 2000 12:33:31 -0500 (EST) Date: Thu, 16 Mar 2000 12:33:31 -0500 (EST) From: Pulp To: genomic@egroups.com In-Reply-To: <20000316172451.63159.qmail@h...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: No Subject MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > Fair enough. To start anew: > > Hi, I'm Pulp. Glad to be here. > > Joshua Millard == pulp@w... && www.wpi.edu/~pulp > > *chuckles* > > "Hi, I'm Pulp, signed, Joshua" > > I'll get me coat.... By god, I tried to get rid o' that ambiguity, but it keeps comin' back! I don't usually ponder my .sig too often, but hey, it says pulp a couple time, eh? Sure, it says my given name too, but, well, that's the way I like it. If it's going to disturb anyone, I suppose I could try and rig up a trick to attach a different sig to the genomic emails, but, well, gah! We're all smart folks, I think. Pulp (please disregard the following ambiguous signature file) Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From Graeme Jefferis Thu Mar 16 09:53:26 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 16 Mar 2000 17:53:40 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 30009 invoked from network); 16 Mar 2000 17:53:06 -0000 Received: from grieg.dmu.ac.uk (HELO dmu.ac.uk) (146.227.1.5) by qh.egroups.com with SMTP; 16 Mar 2000 17:53:06 -0000 Received: from garozzo.cse.dmu.ac.uk (root@g... [146.227.102.42]) by dmu.ac.uk (8.10.0.Beta12/8.10.0.Beta12) with ESMTP id e2GHpav26265 for ; Thu, 16 Mar 2000 17:51:36 GMT Received: from ibis.cs.cse.dmu.ac.uk (se98gj@i... [146.227.102.31]) by garozzo.cse.dmu.ac.uk (8.9.3/8.9.3/g3.1b) with ESMTP id RAA03885 for ; Thu, 16 Mar 2000 17:53:04 GMT From: Graeme Jefferis Received: (from se98gj@l...) by ibis.cs.cse.dmu.ac.uk (8.9.3/8.9.3/c1.8) id RAA29045 for genomic@egroups.com; Thu, 16 Mar 2000 17:53:03 GMT Date: Thu, 16 Mar 2000 17:53:03 GMT Message-Id: <200003161753.RAA29045@i...> To: genomic@egroups.com Content-MD5: 0cKXtNndfFNvTO3kM+9Jxw== Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: No Subject MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > ... If it's going to disturb anyone, I suppose I could try and > rig up a trick to attach a different sig to the genomic emails, but, well, > gah! We're all smart folks, I think. > Quite so, though I'm sure no offence was meant. My introductory piece follows near-immediately... -Graeme. From Graeme Jefferis Thu Mar 16 10:00:10 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 18:00:23 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 2947 invoked from network); 16 Mar 2000 18:00:20 -0000 Received: from chopin.dmu.ac.uk (HELO dmu.ac.uk) (146.227.1.74) by qg.egroups.com with SMTP; 16 Mar 2000 18:00:20 -0000 Received: from garozzo.cse.dmu.ac.uk (root@g... [146.227.102.42]) by dmu.ac.uk (8.10.0.Beta12/8.10.0.Beta12) with ESMTP id e2GHwuD21197 for ; Thu, 16 Mar 2000 17:58:56 GMT Received: from ibis.cs.cse.dmu.ac.uk (se98gj@i... [146.227.102.31]) by garozzo.cse.dmu.ac.uk (8.9.3/8.9.3/g3.1b) with ESMTP id SAA04094 for ; Thu, 16 Mar 2000 18:00:19 GMT From: Graeme Jefferis Received: (from se98gj@l...) by ibis.cs.cse.dmu.ac.uk (8.9.3/8.9.3/c1.8) id SAA29054 for genomic@e...; Thu, 16 Mar 2000 18:00:18 GMT Date: Thu, 16 Mar 2000 18:00:18 GMT Message-Id: <200003161800.SAA29054@i...> To: genomic@e... Content-MD5: Rm7kicRsVF8fvzUfYuIKzw== Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Further adventures in introduction. MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Hello: I'm Grimace, sometimes called Graeme Jefferis. I've played (with heavily varying degrees of involvement) Radio Free Nomic, Mornington Nomic and Garden Nomic. Radio Free Nomic is my current Nomic of choice. Oh, I made an abortive attempt to join AckaNomic as well. I'm at De Montfort University in Leicester, UK, where I'm halfway through the second year of a software engineering course. I enjoy games of all flavours; current favorites include Bridge, Icehouse variants, and Kemps. I also play saxophone and clarinet, most notably with a band called Cut Out (http://www.cutout.org.uk) A little more can be found on my homepage. http://www.cse.dmu.ac.uk/~se98gj/ Enough of that. -Grimace. From Thu Mar 16 13:07:42 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 21:07:56 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 19142 invoked from network); 16 Mar 2000 21:07:51 -0000 Received: from mr.egroups.com (10.1.1.37) by iqh.egroups.com with SMTP; 16 Mar 2000 21:07:51 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.130] by mr.egroups.com with NNFMP; 16 Mar 2000 21:07:50 -0000 Date: Thu, 16 Mar 2000 13:07:49 -0800 From: "Oloros" To: genomic@e... Message-ID: <8arif5$3cuu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Just how many weeks does anyone think that Genomic will last before there are victory conditions imposed? Does anyone have arguments for or against such conditions? -Oloros From RavenBlack Thu Mar 16 14:14:41 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 22:14:54 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 23322 invoked from network); 16 Mar 2000 22:14:53 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 16 Mar 2000 22:14:53 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12ViXb-000156-00 for genomic@e...; Thu, 16 Mar 2000 17:14:52 -0500 Message-Id: <3.0.2.32.20000316171622.03085ff0@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Thu, 16 Mar 2000 17:16:22 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8arif5$3cuu@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >Just how many weeks does anyone think that Genomic will last before >there are victory conditions imposed? Does anyone have arguments for >or against such conditions? Yes, I have arguments For... There isn't much point in a set of Rules if there isn't a destination of some sort. Not necessarily a winning condition, but such is by far the easiest to come by. I can't think of any arguments Against - part of the point of a Nomic, to my eye, is modifying the Rules so that, though there is a winning condition, nobody (except yourself) reaches it. --RavenBlack From Thu Mar 16 14:38:16 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 22:38:30 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 14605 invoked from network); 16 Mar 2000 22:38:28 -0000 Received: from f247.law8.hotmail.com (HELO hotmail.com) (216.33.241.247) by qg.egroups.com with SMTP; 16 Mar 2000 22:38:28 -0000 Received: (qmail 4049 invoked by uid 0); 16 Mar 2000 22:38:28 -0000 Message-ID: <20000316223828.4048.qmail@h...> Received: from 204.60.28.207 by www.hotmail.com with HTTP; Thu, 16 Mar 2000 14:38:28 PST X-Originating-IP: [204.60.28.207] From: "Tyrethali Ansrath" To: genomic@egroups.com Date: Thu, 16 Mar 2000 17:38:28 EST Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain; format=flowed Content-Transfer-Encoding: 7bit Well, for the Against side, it's a shame to play a nomic for a while, having all sorts of fun, then watching it end because someone got a few extra points or something. While I have nothing against ranking systems or points or such, most "winning" conditions of other nomics are more like area-specific reset buttons. Which is another thing I don't mind. But then again, I always see playing Nomic as fun in itself, rather than trying to "win" it. Sub-games, on the other hand... ______________________________________________________ From Thu Mar 16 14:46:46 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 16 Mar 2000 22:47:00 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13787 invoked from network); 16 Mar 2000 22:46:58 -0000 Received: from smtp.screaming.net (212.49.224.20) by qh.egroups.com with SMTP; 16 Mar 2000 22:46:58 -0000 Received: from thetwistedone (dyn101-ras18.froglike.co.uk [212.49.241.101]) by smtp.screaming.net (8.9.3/8.9.3) with SMTP id WAA05761 for ; Thu, 16 Mar 2000 22:47:44 GMT Message-ID: <000401bf8f99$7d680300$0100a8c0@t...> From: "TheTwistedOne" To: Date: Thu, 16 Mar 2000 19:54:11 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.00.2919.6700 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2919.6700 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Morning, May I suggest that we please don't use the egroups thing to post messages, if at all possible? Outlook Express is completely incapable of understanding that it shouldn't try and connect to the net about 4 times for each tag in a mail. It's infuriating, to say the least. If, of course, you have no easily accessible alternative, then I completely understand. Thanks, TheTwistedOne mailto:thetwistedone@t... http://www.thetwistedzone.net From Thu Mar 16 16:25:08 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 00:25:21 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 16856 invoked from network); 17 Mar 2000 00:25:19 -0000 Received: from mr.egroups.com (10.1.1.37) by iqg.egroups.com with SMTP; 17 Mar 2000 00:25:19 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.130] by mr.egroups.com with NNFMP; 17 Mar 2000 00:25:19 -0000 Date: Thu, 16 Mar 2000 16:25:15 -0800 From: "Oloros" To: genomic@e... Message-ID: <8aru1b$o15t@e...> In-Reply-To: <000401bf8f99$7d680300$0100a8c0@t...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit guilty as charged, but perhaps . . . > May I suggest that we please don't use the egroups thing to post messages, > if at all possible? > You may want to check your user-settings in egroups (button: "my space"; button: "user info") and toggle the "default settings". > If, of course, you have no easily accessible alternative, then I completely > understand. > It is just easier to manage my aliases using the egroups email client. Let us know if this does not work out. From Thu Mar 16 18:23:35 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 02:23:49 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 5635 invoked from network); 17 Mar 2000 02:23:48 -0000 Received: from fg.egroups.com (10.1.2.134) by iqh.egroups.com with SMTP; 17 Mar 2000 02:23:48 -0000 X-eGroups-Return: se98gj@d... Received: from [10.1.2.16] by fg.egroups.com with NNFMP; 17 Mar 2000 02:23:48 -0000 Date: Thu, 16 Mar 2000 18:23:42 -0800 From: "Graeme Jefferis" To: genomic@e... Message-ID: <8as4ve$bhrr@e...> In-Reply-To: <8arif5$3cuu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Just how many weeks does anyone think that Genomic will last before > there are victory conditions imposed? Does anyone have arguments for > or against such conditions? Hm. Hopefully a little longer yet - it would be nice to get a bit of a distinctive 'feel' before we start implementing methods to win by. I'm never into the usual win-by-paradox scheming, really. I think such winning strategies often just encourage poorly worded rules. You can correctly argue that that's the real point of Nomic, but I just play for fun, happier to play straight and win by some points system or what-have-you. Loophole surfing's a different matter; the more ingenious, the better. And a few nice innovative sub-games wouldn't go amiss either. Oh, while I'm at it, ruleset structure always becomes a bugbear after the first few weeks of a Nomic's life. If it becomes clear that things are going to get messy, I'd rather impose a structure early, than be shunting lots of rules around later. -Grimace. From RavenBlack Thu Mar 16 19:00:40 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 03:00:53 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 29826 invoked from network); 17 Mar 2000 03:00:51 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qh.egroups.com with SMTP; 17 Mar 2000 03:00:51 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12Vn0G-000347-00 for genomic@e...; Thu, 16 Mar 2000 22:00:44 -0500 Message-Id: <3.0.2.32.20000316220219.0308d440@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Thu, 16 Mar 2000 22:02:19 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8as4ve$bhrr@e...> References: <8arif5$3cuu@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >Oh, while I'm at it, ruleset structure always becomes a bugbear after >the first few weeks of a Nomic's life. If it becomes clear that things >are going to get messy, I'd rather impose a structure early, than >be shunting lots of rules around later. It seems to me that this, discussion of subgames, questions of winning methods... All are moot, in a way. That's what gets decided by the vote. Unless you're inquiring as to whether certain forms of Proposal will get a winning vote... Not that I'm saying such discussion is bad, mind. It's for the entertainment, of course. Plus it repeated some webpage addresses such that I visited them and found splend things. Who here would play a Java-ised online version of Icehouse? ( http://www.wunderland.com/icehouse/IcehouseTOC.html ) (Icehouse is one of the splend things - thanks, Grimace) And, dammit, does anyone know how to do a multi-player Java thing without running a server for it? Is there a better way than interfacing to a file on a website through a Perl script? Okay, so I'm off topic. But I believe everyone introduced themselves as programmers or other sorts of geek, so... nyah. --RavenBlack raven@r... ICQ 3105892 http://www.ravenblack.net/ Why do fools fall in love? So they can reproduce and outnumber us. From Thu Mar 16 23:34:31 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 07:34:45 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 11419 invoked from network); 17 Mar 2000 07:34:44 -0000 Received: from ci.egroups.com (10.1.2.81) by iqh.egroups.com with SMTP; 17 Mar 2000 07:34:44 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.119] by ci.egroups.com with NNFMP; 17 Mar 2000 07:34:44 -0000 Date: Thu, 16 Mar 2000 23:34:40 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8asn6g$j5oq@e...> In-Reply-To: <8aqs6u$36lk@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: i love to join your game MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Hey, Paul - I have a self-developed board game on the shelf - Its called "Crime Pays". Perhaps you would be the person to move it along to the next level. Drop me an EMail if you think you would be interested in discussing it. -Mac From Thu Mar 16 23:45:27 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 07:45:41 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 17203 invoked from network); 17 Mar 2000 07:45:39 -0000 Received: from b05.egroups.com (10.1.2.184) by iqh.egroups.com with SMTP; 17 Mar 2000 07:45:39 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.7] by b05.egroups.com with NNFMP; 17 Mar 2000 07:45:39 -0000 Date: Thu, 16 Mar 2000 23:45:32 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8asnqs$l3qv@e...> In-Reply-To: <8arif5$3cuu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "oloros" wrote: > Just how many weeks does anyone think that Genomic will last before > there are victory conditions imposed? Does anyone have arguments for > or against such conditions? Personally: I've never proposed a win condition. I've voted for one, and it passed. I don't much care for win conditions. Is an especially appealing one comes along, I will not hesitate to vote for it. My guess: 1st Win Condition Proposal: Week 3 1st Win Condition Proposal bing passed: Week 7 ist Win: Week 14 Its just a guess. To spite me, someone may suggest one THIS week. - Mac From Thu Mar 16 23:55:14 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 07:55:28 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 23710 invoked from network); 17 Mar 2000 07:55:26 -0000 Received: from mq.egroups.com (10.1.1.36) by iqh.egroups.com with SMTP; 17 Mar 2000 07:55:26 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.123] by mq.egroups.com with NNFMP; 17 Mar 2000 07:55:26 -0000 Date: Thu, 16 Mar 2000 23:55:23 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8asodb$c33l@e...> In-Reply-To: <3.0.2.32.20000316171622.03085ff0@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit ravenblack wrote: > I can't think of any arguments Against - part of the > point of a Nomic, to my eye, is modifying the Rules so > that, though there is a winning condition, nobody > (except yourself) reaches it. That is a refreshingly different perspective from my own: Since most nomics do not close up shop when the eventually proposed win condition is achieved, what is won becomes debatable. Satisfying, perhaps, but the uber-game is never really won...anything which IS won is a sub-game. There may be many such sub-games. A perspective, not an argument. - Mac From Fri Mar 17 00:02:42 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 08:02:56 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 27896 invoked from network); 17 Mar 2000 08:02:54 -0000 Received: from cj.egroups.com (10.1.2.82) by iqh.egroups.com with SMTP; 17 Mar 2000 08:02:54 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.124] by cj.egroups.com with NNFMP; 17 Mar 2000 08:02:54 -0000 Date: Fri, 17 Mar 2000 00:01:40 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8asop4$dg7g@e...> In-Reply-To: <000401bf8f99$7d680300$0100a8c0@t...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "thetwistedone" wrote: > May I suggest that we please don't use the egroups thing to post messages, > if at all possible? Outlook Express is completely incapable of understanding > that it shouldn't try and connect to the net about 4 times for each src=> tag in a mail. It's infuriating, to say the least. If my access to this Nomic involved some kind of EMail client, instead of whatever this navigation tool I'm using now happens to be, I sincerely doubt that I would participate. ::shrug:: I use outlook for my mail. Whatever I am doing here, I do not consider it EMail. - Mac From Fri Mar 17 00:19:14 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 08:19:28 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 14711 invoked from network); 17 Mar 2000 08:19:26 -0000 Received: from c9.egroups.com (10.1.2.66) by iqg.egroups.com with SMTP; 17 Mar 2000 08:19:26 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.129] by c9.egroups.com with NNFMP; 17 Mar 2000 08:19:26 -0000 Date: Fri, 17 Mar 2000 00:19:18 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8aspq6$ouu2@e...> In-Reply-To: <3.0.2.32.20000316220219.0308d440@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit ravenblack wrote: > And, dammit, does anyone know how to do a multi-player Java > thing without running a server for it? Is there a better way > than interfacing to a file on a website through a Perl script? > Okay, so I'm off topic. But I believe everyone introduced > themselves as programmers or other sorts of geek, so... nyah. I've been considering this for some time now, and while I recognise it is beyond my current expertise, I'm nearly certain its what I'll end up having to do. If you can put a perlscript on the web-server, you should be able to put up a java servlet as well. That server would still be the one executing the code. OTOH, can Applets establish socket connections? If so, the game would require a hosting player to run the "Host" applet, and players would probably have to be told what socket connection to use. Perhaps meeting in a chatroom of some sort to coordinate, and then another application for the game. I'm working on this same problem, so if you get a better answer, I hope you won't mind sharing it with me. - Mac From Fri Mar 17 01:54:24 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 09:54:38 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 687 invoked from network); 17 Mar 2000 09:54:36 -0000 Received: from ck.egroups.com (10.1.2.83) by iqg.egroups.com with SMTP; 17 Mar 2000 09:54:36 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.119] by ck.egroups.com with NNFMP; 17 Mar 2000 09:54:36 -0000 Date: Fri, 17 Mar 2000 01:52:09 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8asv89$j7ni@e...> In-Reply-To: <8asodb$c33l@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Winalot MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Thirty-eight messages? Grief. You have been busy. > Since most nomics do not close up shop when the eventually proposed win > condition is achieved, what is won becomes debatable. Satisfying, > perhaps, but the uber-game is never really won...anything which IS won > is a sub-game. > There may be many such sub-games. I think this is the way to go, really - it'd be a bit sad if there was a way to win Genomic in a "right, put the pieces away and start again" fashion, because it'd mean throwing away everything we'd spent 'x' weeks building up. The winner of a casual face-to-face Nomic is fair enough, since they only take an hour or two of your life, but closing the box on an epic Internet Nomic seems quite wasteful. In my mind, "winning" should involve nothing more than applauding the winning Player, resetting everyones scores (or pennies, or genes, or trilobites, or cigarettes) and then continuing to play, seeing who can win next. Or something to that effect (maybe giving the previous winner a head start, or handicap). Winning should be a way of giving a talented Player some credit for their achievement (which, if particularly interesting, might be documented on the Web page somewhere), as well as providing a neat way to divide the Nomic into little eras ("Game 1 was won by Raven on the 6th of April when he destroyed everyone's starships in a supernova", "Game 2 was won by Mac on the 14th of June when he bribed the Voting Droid to vote through a 'Mac wins the game' Proposal", etc.). As for how soon such a thing springs up, I'm not really bothered. And could happily survive without one - dear old Mornington Nomic has been focused entirely on subgames for a good couple of years, now, with absolutely no concept of a "Nomic winner", and it's perfectly enjoyable just tinkering the rules. I'm in this game for the creativity and amusement, above all else. Having a goal to aim for is fair enough, but can be as easily boring as dramatic, really. (cf. ParaNomic) Kevan -- kevan@s... http://www.stormloader.com/kevan From RavenBlack Fri Mar 17 08:54:00 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 16:54:15 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 14916 invoked from network); 17 Mar 2000 16:54:13 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 17 Mar 2000 16:54:13 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12W00q-00063O-00 for genomic@e...; Fri, 17 Mar 2000 11:54:12 -0500 Message-Id: <3.0.2.32.20000317115433.030f8d60@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Fri, 17 Mar 2000 11:54:33 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8aspq6$ouu2@e...> References: <3.0.2.32.20000316220219.0308d440@w...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit [Java multi-player thing with no server] I was posting a long off-topic message, here, then figured it's very off-topic, and long, so instead I shall make it a link. Anyone interested in this topic, mail me and I'll throw a pseudo sub-list together for it if there's a few of you. The message is here http://www.ravenblack.net/icehouse/discussion.txt --RavenBlack From Fri Mar 17 10:48:33 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 18:48:46 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13570 invoked from network); 17 Mar 2000 18:48:23 -0000 Received: from oe42.law7.hotmail.com (HELO hotmail.com) (216.33.236.37) by mx3.egroups.com with SMTP; 17 Mar 2000 18:48:23 -0000 Received: (qmail 61323 invoked by uid 65534); 17 Mar 2000 18:48:23 -0000 Message-ID: <20000317184823.61322.qmail@h...> X-Originating-IP: [213.1.197.235] From: "Adam S" To: References: <000401bf8f99$7d680300$0100a8c0@t...> Date: Thu, 16 Mar 2000 23:28:40 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0010_01BF8F9F.5CE13BA0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0010_01BF8F9F.5CE13BA0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Hmmm. Is there no way to set your e-mail up to ignore HTML tags? or simply turn off auto connect ? :) Adam May I suggest that we please don't use the egroups thing to post messages, if at all possible? Outlook Express is completely incapable of understandin= g that it shouldn't try and connect to the net about 4 times for each tag in a mail. It's infuriating, to say the least. If, of course, you have no easily accessible alternative, then I completely understand. Thanks, TheTwistedOne mailto:thetwistedone@t... http://www.thetwistedzone.net ---------------------------------------------------------------------------= ----- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0010_01BF8F9F.5CE13BA0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Hmmm. Is there no way to set your e-mail up to ignore H= TML = tags?
 
 
or simply turn off auto connect ? :)
 
Adam
 

May I suggest that we please don't use the egroups thing to post = messages,
if at all possible? Outlook Express is completely incapable of= = understanding
that it shouldn't try and connect to the net about 4 times= for = each <img
src=3D> tag in a mail. It's infuriating, to say the = least.

If, of course, you have no easily accessible alternative, the= n I = completely
understand.

Thanks,

TheTwistedOne
mailto:thetwistedone@t...= ne.net
http://www.thetwistedzone.net

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0010_01BF8F9F.5CE13BA0-- From oloros@b... Fri Mar 17 11:33:45 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 17 Mar 2000 19:34:00 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 12921 invoked from network); 17 Mar 2000 19:33:58 -0000 Received: from c004-h012.c004.sfo.cp.net (HELO c004.sfo.cp.net) (209.228.14.98) by qg.egroups.com with SMTP; 17 Mar 2000 19:33:58 -0000 Received: (cpmta 11163 invoked from network); 17 Mar 2000 11:33:57 -0800 Date: 17 Mar 2000 11:33:57 -0800 Message-ID: <20000317193357.11162.cpmta@c...> X-Sent: 17 Mar 2000 19:33:57 GMT Received: from [209.152.157.2] by mail.britannica.com with HTTP; 17 Mar 2000 11:33:57 PST Content-Disposition: inline To: genomic@egroups.com From: oloros@b... X-Mailer: Web Mail 3.5.1.4 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit On Thu, 16 March 2000, "Mac" wrote: > >My guess: 1st Win Condition Proposal: Week 3 > 1st Win Condition Proposal being passed: Week 7 > ist Win: Week 14 > >Its just a guess. To spite me, someone may suggest one THIS week. > I'd make a wager, if I had anything with which to do so. Or a betting-pool, if we all did. My own guess: There is a Win Condition proposed for next week (not one from me); it will not be passed; and the First Era of Genomic shall be won between weeks 21 and 24. Just shooting from the hip, -Oloros ______________________________________________ Get free e-mail at http://www.britannica.com From Fri Mar 17 18:27:14 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 18 Mar 2000 02:27:28 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 26918 invoked from network); 18 Mar 2000 02:27:27 -0000 Received: from smtp.screaming.net (212.49.224.20) by mx3.egroups.com with SMTP; 18 Mar 2000 02:27:27 -0000 Received: from thetwistedone (dyn150-ras19.froglike.co.uk [212.49.242.150]) by smtp.screaming.net (8.9.3/8.9.3) with SMTP id CAA11138 for ; Sat, 18 Mar 2000 02:28:14 GMT Message-ID: <001c01bf9081$75616000$0100a8c0@t...> From: "TheTwistedOne" To: References: <000401bf8f99$7d680300$0100a8c0@t...> <20000317184823.61322.qmail@h...> Date: Sat, 18 Mar 2000 02:27:02 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.00.2919.6700 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2919.6700 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Morning all, Adam S: >Hmmm. Is there no way to set your e-mail up to ignore HTML tags? Nope. Such is the "user-friendly" approach of Microsoft consumer products. >or simply turn off auto connect ? :) I have auto-connect turned off. Hence it's insistence on popping up the dialup connection dialog, asking me to connect. Mac: >If my access to this Nomic involved some kind of EMail client, instead >of whatever this navigation tool I'm using now happens to be, I >sincerely doubt that I would participate. ::shrug:: Hence my saying that only if possible, don't use it. I don't want to be the cause of anyone not playing. Such would make me a batstand. >Whatever I am doing here, I do not consider it EMail. Whatever you post here, gets sent to the mailing list, via email. Therefore, it is email. But again, I don't want to try and force anything on anyone. I'm just making it clear that eGroups seem to be a little uncaring of people who don't have permanent, free connections to the internet, or a dislike for HTML emails. Oloros: >You may want to check your user-settings in egroups (button: "my >space"; button: "user info") and toggle the "default settings". Distressingly, my profile says that I use a plain-text email client. Yet the eGroups list-thing insists on sending me HTML-formatted email. Yum. >It is just easier to manage my aliases using the egroups email client. Fair enough. Everyone: Whatever. It was merely a request, because the eGroups thing seems ill-thought out and inconsiderate, especially when the mailing list is to be read by Outlook Express. Since the opinion seems to be that the eGroups thing is easier for others, I shall use it too, and treat the copies I receive on the mailing list as a backup. No biggie. I'm really just looking forward to seeing what everyone's come up with in this first week. I know I had fun, stretching my mental legs, trying to get into the mind-frame for decent Proposals. I hope I've at least partially succeeded. TheTwistedOne mailto:thetwistedone@t... http://www.thetwistedzone.net From RavenBlack Fri Mar 17 19:56:51 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 18 Mar 2000 03:57:06 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 24770 invoked from network); 18 Mar 2000 03:57:05 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 18 Mar 2000 03:57:05 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12WAMK-0004he-00 for genomic@egroups.com; Fri, 17 Mar 2000 22:57:04 -0500 Message-Id: <3.0.2.32.20000317225752.0076501c@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Fri, 17 Mar 2000 22:57:52 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <001c01bf9081$75616000$0100a8c0@t...> References: <000401bf8f99$7d680300$0100a8c0@t...> <20000317184823.61322.qmail@h...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit Actually, someone already made this point, but they didn't make it very clearly. Here's how to get the HTML to go away. Go to http://www.egroups.com/group/genomic/ (at least, that's the point I'm starting this from) Click the "My space" button near the top. (and sign in if you're not cookie'd in) Click the "User info" tab on the left. Click "Edit" next to default settings. At this point you may have already seen the "Email client" thing, which, when editing your preferences, you can set to "Plain text only". Problem solved. "You may have already won". --RavenBlack raven@r... ICQ 3105892 http://www.ravenblack.net/ "The Crow wish'd everything was black, The Owl that everything was white." From Sat Mar 18 04:13:25 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 18 Mar 2000 12:13:39 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 29465 invoked from network); 18 Mar 2000 12:13:37 -0000 Received: from smtp.screaming.net (212.49.224.20) by qg.egroups.com with SMTP; 18 Mar 2000 12:13:37 -0000 Received: from thetwistedone (dyn163-ras28.froglike.co.uk [212.49.251.163]) by smtp.screaming.net (8.9.3/8.9.3) with SMTP id MAA25121 for ; Sat, 18 Mar 2000 12:14:25 GMT Message-ID: <003101bf90d3$586beb30$0100a8c0@t...> From: "TheTwistedOne" To: References: <000401bf8f99$7d680300$0100a8c0@t...> <20000317184823.61322.qmail@h...> <3.0.2.32.20000317225752.0076501c@w...> Date: Sat, 18 Mar 2000 12:12:29 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.00.2919.6700 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2919.6700 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit > Here's how to get the HTML to go away. > Go to http://www.egroups.com/group/genomic/ > (at least, that's the point I'm starting this from) > Click the "My space" button near the top. (and sign in if > you're not cookie'd in) > Click the "User info" tab on the left. > Click "Edit" next to default settings. > At this point you may have already seen the "Email client" > thing, which, when editing your preferences, you can set > to "Plain text only". Problem solved. Are you paying attention? I don't think you're paying attention, are you? :) "Distressingly, my profile says that I use a plain-text email client. Yet the eGroups list-thing insists on sending me HTML-formatted email. Yum." I understood what Oloros advised; I checked it. I am set as using a plain-text email client. Have been since I created my account. Although, having said that, the last few messages /have/ been plain text. Perhaps the system picked me for random annoyance, or something [shrugs] TheTwistedOne mailto:thetwistedone@t... http://www.thetwistedzone.net From RavenBlack Sat Mar 18 08:01:33 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 18 Mar 2000 16:01:47 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 8758 invoked from network); 18 Mar 2000 16:01:45 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qh.egroups.com with SMTP; 18 Mar 2000 16:01:45 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12WLfd-0002Mp-00 for genomic@egroups.com; Sat, 18 Mar 2000 11:01:45 -0500 Message-Id: <3.0.2.32.20000318110257.030ffe14@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Sat, 18 Mar 2000 11:02:57 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <003101bf90d3$586beb30$0100a8c0@t...> References: <000401bf8f99$7d680300$0100a8c0@t...> <20000317184823.61322.qmail@h...> <3.0.2.32.20000317225752.0076501c@w...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: eGroups and HTML mail MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >Are you paying attention? I don't think you're paying >attention, are you? :) No, not really. Probably nor was the egroups profile setting, though, since it ignored some of the things I set there, until I set them again. --RavenBlack From Sun Mar 19 07:33:59 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 19 Mar 2000 15:34:14 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 4784 invoked from network); 19 Mar 2000 15:34:12 -0000 Received: from mo.egroups.com (10.1.1.34) by iqh.egroups.com with SMTP; 19 Mar 2000 15:34:12 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.121] by mo.egroups.com with NNFMP; 19 Mar 2000 15:34:12 -0000 Date: Sun, 19 Mar 2000 07:34:11 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b2s1j$b1j3@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week-End Reminder MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Hello. Just a reminder that Week One ends tomorrow at 1pm (GMT), whatever that might translate to for your timezone. If you've got any Proposals you plan to submit this Week, and haven't already sent them to me, be sure to get them in by the end of the Week. (And if you've got some Proposals ready but haven't actually signed up as a Player yet, feel free to cough out a combined entry-request-and-Proposal-list.) Depending on how much work I've got and how sunny it is, Interregnum One should start at 1:00pm and finish at about 1:10pm. An impressive array of Proposals has already been thrown at me, anyway; I look forward to seeing the discussion of them when they hit the mailing list. Unexpectedly pleasing to see so many people putting the effort in. Your Speaker, Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 20 03:10:19 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 11:10:34 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 28245 invoked from network); 20 Mar 2000 11:10:03 -0000 Received: from ef.egroups.com (10.1.2.111) by iqh.egroups.com with SMTP; 20 Mar 2000 11:10:03 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.16] by ef.egroups.com with NNFMP; 20 Mar 2000 11:10:03 -0000 Date: Mon, 20 Mar 2000 03:10:00 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8b50u8$arno@e...> In-Reply-To: <200003161800.SAA29054@i...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further adventures in introduction. MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Hello: I'm Grimace, sometimes called Graeme Jefferis. Hey, Grimmace - nice to see you again. I was Abirrond in the Garden. - Mac From Mon Mar 20 03:17:37 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 11:17:53 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8366 invoked from network); 20 Mar 2000 11:17:51 -0000 Received: from fg.egroups.com (10.1.2.134) by iqg.egroups.com with SMTP; 20 Mar 2000 11:17:51 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.6] by fg.egroups.com with NNFMP; 20 Mar 2000 11:17:51 -0000 Date: Mon, 20 Mar 2000 03:17:47 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8b51cr$9qsp@e...> In-Reply-To: <8as4ve$bhrr@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "graeme jefferis" wrote: > Oh, while I'm at it, ruleset structure always becomes a bugbear after > the first few weeks of a Nomic's life. If it becomes clear that things > are going to get messy, I'd rather impose a structure early, than > be shunting lots of rules around later. You should look at the rules for McNomic. Keven thinks they are scandolously awkward. I love them. If a rule needs to be shunted, we propose to shunt it. We are only here to edit one document. From Mon Mar 20 03:37:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 11:37:21 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8415 invoked from network); 20 Mar 2000 11:37:18 -0000 Received: from mr.egroups.com (10.1.1.37) by iqh.egroups.com with SMTP; 20 Mar 2000 11:37:18 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.120] by mr.egroups.com with NNFMP; 20 Mar 2000 11:37:18 -0000 Date: Mon, 20 Mar 2000 03:37:08 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8b52h4$2era@e...> In-Reply-To: <3.0.2.32.20000317115433.030f8d60@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit ravenblack wrote: > The message is here > http://www.ravenblack.net/icehouse/discussion.txt Jesus Murphy, Ravenblack...there is so much in that message I want to talk to. Its not gonna happen tonight tho. From Mon Mar 20 03:40:28 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 11:40:43 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 9953 invoked from network); 20 Mar 2000 11:40:42 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 20 Mar 2000 11:40:42 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.123] by mv.egroups.com with NNFMP; 20 Mar 2000 11:40:42 -0000 Date: Mon, 20 Mar 2000 03:40:34 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8b52ni$c81m@e...> In-Reply-To: <20000317193357.11162.cpmta@c...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: chatter in the outfield MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit oloro-@b... wrote: > There is a Win Condition proposed for next week (not one from me); it will not be passed; and the First Era of Genomic shall be won between weeks 21 and 24. > Just shooting from the hip, Between the two of us, I think we have the basis for a bettingpool here. That would certainly queer this up... From Mon Mar 20 04:01:19 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 12:01:34 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 31108 invoked from network); 20 Mar 2000 12:01:32 -0000 Received: from oe25.law7.hotmail.com (HELO hotmail.com) (216.33.236.245) by qg.egroups.com with SMTP; 20 Mar 2000 12:01:32 -0000 Received: (qmail 9793 invoked by uid 65534); 20 Mar 2000 12:01:32 -0000 Message-ID: <20000320120132.9792.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b50u8$arno@e...> Date: Mon, 20 Mar 2000 12:00:15 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further adventures in introduction. MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0029_01BF9263.DAB4C1C0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0029_01BF9263.DAB4C1C0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable >I was Abirrond in the Garden. Sounds like 'Cluedo' .... (or 'Clue' for Americans....) Adam ------=_NextPart_000_0029_01BF9263.DAB4C1C0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
>I was Abirrond in the Garden.

Sounds like 'Cluedo' .... (or 'Clue' for Americans....)
 
Adam
------=_NextPart_000_0029_01BF9263.DAB4C1C0-- From Mon Mar 20 05:03:30 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 13:03:45 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 5457 invoked from network); 20 Mar 2000 13:03:45 -0000 Received: from mw.egroups.com (10.1.2.2) by iqg.egroups.com with SMTP; 20 Mar 2000 13:03:45 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.128] by mw.egroups.com with NNFMP; 20 Mar 2000 13:03:45 -0000 Date: Mon, 20 Mar 2000 05:03:42 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b57je$lko0@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week One Ends MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Week One has now ended. Proposals for Week Two will be coughed out to the mailing list momentarily, and also nailed up on the Web page. All Players can then cast votes on each Proposal anywhen before 1:00pm (GMT) on Monday the 27th of March, although it's probably best to wait and see what mailing list discussion they get before submitting any votes. Brace yourselves. Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 20 05:08:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 13:08:20 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 28971 invoked from network); 20 Mar 2000 13:08:07 -0000 Received: from mq.egroups.com (10.1.1.36) by iqh.egroups.com with SMTP; 20 Mar 2000 13:08:07 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.119] by mq.egroups.com with NNFMP; 20 Mar 2000 13:08:06 -0000 Date: Mon, 20 Mar 2000 05:08:00 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b57rg$rre8@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit +-------------------------------------------------------+ | GENOMIC PROPOSALS - Year One, Week Two | +-------------------------------------------------------+ ----------------------------------------------------------------------- ------ Proposal 001 - Your Vote can make a difference! In Rule 6 (Votes), replace the sentence "During a given Week, each Player may cast one Vote for every Proposal that was distributed by the Speaker at the start of that Week." with "During a given Week, each Player may cast one Vote with regards to each Proposal that was distributed by the Speaker at the start of that Week." ----------------------------------------------------------------------- ------ Proposal 002 - Cash in your chips Enact a new Rule:- A Player, having submitted the maximum allowable number of Proposals in a given Week, may choose to exchange their right to Vote on two Proposals during the same Week in order to submit one more Proposal. Likewise, a Player having cast their Votes for a given Week, may exchange one Proposal for the same Week in order that they may cast one extra Vote. A Vote gained by exchanging a Proposal may not be in favour of one of the Players own Proposals. A Player may not request a Proposal should e have remaining Proposals, nor may e request a Vote should e have remaining Votes. The desire to exchange Proposals or Votes should be expressed at the top of the Proposal or Vote. The Speaker may accept or refuse the request, and is under no obligation to give a reason as to why, but must inform the Player of the decision. If the Speaker rejects the request, the Vote or Proposal is illegal, and the Player's count of remaining Votes/Proposals remains unaltered. Should the Speaker accept the request, the request shall be removed from the text of the Proposal/Vote. ----------------------------------------------------------------------- ------ Proposal 003 - Proposing is its own reward Amend the first sentence of rule 5 to read: "During a given Week, each Player may submit a number of Proposals equal to four plus the number of Proposals that Player submitted that passed during the last Interregnum." ----------------------------------------------------------------------- ------ Proposal 004 - Megalomaniacs Anonymous Enact a new Rule:- TheTwistedOne may overturn the democratic process, including (but not necessarilt limited to) forcing a Proposal through into the Ruleset, or blocking a Proposal. This is regardless of the way the Votes fall. ----------------------------------------------------------------------- ------ Proposal 005 - Democratica mortis Repeal Rule 8 (Justice). ----------------------------------------------------------------------- ------ Proposal 006 - Paradox! Enact a new rule:- Proposals shall be considered for incorporation into the Ruleset (ie be Voted upon) in order of submission; that is, the datetime upon which the Speaker received the Proposal (and /not/ the datetime upon which the Player initiated the submission). This Rule allows that a Player may submit further Proposals, based on Proposals previously submitted to the Speaker, but not yet distributed to the mailing list and Voted upon, in the knowledge that e and it won't look absurd, and 'lose' valuable Proposal opportunities. This will help to prevent clashes between Proposals. Quite simply, the earlier submitted Proposal takes precedence over the later. When casting their Votes, Players must therefore take into consideration not only the Ruleset as it stands, but also Proposals which have passed (or not) before. ----------------------------------------------------------------------- ------ Proposal 007 - Statistical Analysis Each Player has associated with them a number of Scores. These Scores are maintained by the Speaker, updated during the Interregnum, and posted to the Mailing List and Web Page. There follows a list of the Scores and their descriptions: * Starting Week - the Week at which the Player joined the Game. * Proposals Made - how many Proposals the Player has submitted. * Proposals Accepted - how may of the Player's Proposals have Passed. * Votes Cast - how many Proposals the Player has Voted on. a Vote of "PASS" is counted as a Vote, if it is submitted by the Player and not merely defaulted. Similarly, Weekly Stats are recorded and posted by the Speaker, consisting of: * Proposals Made - how many Proposals there were that Week. * Proposals Accepted - how many of the Week's Proposals Passed. * Votes Cast - how many Votes were cast in the Week. ----------------------------------------------------------------------- ------ Proposal 008 - Siamese Twins If two Proposals have a very similar effect, the Speaker may, at eir discretion, reject the less specific or more poorly worded of them. The Proposer is informed immediately, and the Proposal does not count against their Weekly limit. If one of two such Proposals is made by the Speaker, the Speaker's Proposal must be rejected. ----------------------------------------------------------------------- ------ Proposal 009 - Legalise Creationism We're not really allowed to enact or repeal rules yet. So... Amend Rule 5 (Proposals) to read in its entirety as follows: During a given Week, each Player may submit up to five Proposals. A Proposal is a suggested modification (or a series of modifications) to the Ruleset. Each Proposal must have a title, typically a summary of its aims or a very bad pun. Proposals should be privately emailed to the Speaker. ----------------------------------------------------------------------- ------ Proposal 010 - Gene Genie Enact a new Rule called "DNA":- Each Player has a DNA String, consisting of 23 Genes; these Genes are numbered from one to twenty-three, and each is composed of either adenine, cysosine, guanine or thymine (A, C, G or T, for short). A record of each Player's DNA String shall be maintained by the Speaker, and listed on the Genomic Web Page, along with the resultant phenotypic effects given in the Rule "Just Not My Phenotype". When a new Player joins Genomic, two existing Players are selected at random as parents. A new DNA String is constructed by randomly combining the DNA of both parents (eg. Gene 1 has a 50% chance of being Parent A's Gene 1, and a 50% chance of being Parent B's Gene 1, and so forth); this DNA is then assigned to the new Player. Enact a new Rule called "Just Not My Phenotype":- The Genes of a Player's DNA may influence their powers and abilities in the game of Genomic. The following list describes any Genes which have known effects, for particular chemical components:- Gene 5 - Arms A : Player has no Arms. CG : Player has two Arms. T : Player has four Arms. Gene 6 - Legs A : Player has no Legs. C : Player has two Legs. G : Player has four Legs. T : Player has six Legs. Gene 12 - Mouth A : Player has a toothless Mouth. C : Player has a Beak. G : Player has a toothed Mouth. T : Player has a Mouth with Huge Pointy Teeth. Gene 16 - Size A : Player is Tiny (ant/beetle). C : Player is Small (pigeon/housecat). G : Player is Large (human/lion). T : Player is Huge (elephant/whale). Gene 20 - Eyes A : Player has rudimentary light-sensitive cells (these do not count as Eyes). C : Player has two human-style Eyes. G : Player has two multi-faceted Eyes. T : Player has two hollow chameleon-like Eyes. Gene 23 - Wings A : Player has two Wings. CGT : Player has no Wings. Upon the passage of this Proposal, each Player shall be assigned a randomly-generated DNA String. (This Proposal gives each Player an (insanely simplified) DNA String, and defines what some of the Genes do. As it stands, this doesn't affect the existing game at all; it might be amusing to adjust it to say things like "Player has no arms, and therefore cannot Vote." and give it more of a game impact. And, of course, Players are free to propose definitions of what the spare Genes do. (I imagine it could get quite interesting, and more realistic, to have a single Gene impacting numerous things: Gene 23 becoming "A: Player has wings if Gene 14 is C or Gene 9 is T"; that way, tinkering one Gene could impact the results of a number of others...)) ----------------------------------------------------------------------- ----- Proposal 011 - Data Protection Act In Rule 1 (The Ruleset and How to Obey It), replace "with the sole exception of changing the Ruleset" with "with the exception of changing the Ruleset or any data required to be stored by it". (Game data - such as, say, DNA in the previous Proposal - really needs to be as securely protected as the Ruleset itself.) Also replace "The Rules currently in effect are those most recently posted" with "The Ruleset currently in effect is the one most recently posted". (Extreme pedantry, just clarifying that if the Speaker cheerfully mentions a Rule on a part of the Genomic Web page *other than* the Ruleset page, it doesn't impact anything.) ----------------------------------------------------------------------- ------ Proposal 012 - The Tyrannids Are Coming! Amend Rule 2 - Players and the Speaker - preceding "If the Speaker chooses to accept this application, that person becomes a Player." with "The Speaker may choose to accept an application, on the condition that all references to the Player, in their own application, begin with a capital letter. (Such references include "I" or their name)." ----------------------------------------------------------------------- ------ Proposal 013 - Perls of Wisdom Amend Rule 6, replacing "Votes should be privately emailed to the Speaker" with "Votes may be either privately emailed to the Speaker, or, preferably, cast with the web-based voting interface at http://www.ravenblack.net/~genomic/" ----------------------------------------------------------------------- ------ Proposal 014 - Perls of Wisdom (2) If this Proposal and "Perls of Wisdom" should pass, the effects of the Proposal "Perls of Wisdom" shall be rescinded. RavenBlack will get one extra Proposal next week. Amend Rule 6, replacing "Votes should be privately emailed to the Speaker" with "Votes may be either privately emailed to the Speaker, or, preferably, cast with the web-based voting interface at http://www.ravenblack.net/~genomic/. All Players are assigned a Username and Password for this by the Speaker, when they join." Upon this Proposal passing, all Players who are already in the game are assigned a Username and Password as if they had just joined. ----------------------------------------------------------------------- ------ Proposal 015 - Begin the Beguinne Where Rule 5 states "A Proposal is a suggested modification to the Ruleset, changing the text of any number of Rules.", replace with "A Proposal is a suggested modification, addition, or deletion to the Ruleset, that might change the text of any number of Rules.". ----------------------------------------------------------------------- ------ Proposal 016 - Tom Waits for No One Each Player shall gain one Seniority Point for each week in which that Player submits Votes. The following paragraph shall be added to Rule 7 where appropriate: "The Speaker shall increment the Seniority of each Player, and post a list of Players and their Seniority to the Mailing List." ----------------------------------------------------------------------- ------ Proposal 017 - The Grand Poohbah There exists an Office with the Title of Grand Poohbah, which may be held by any single Player. That Player shall be referred to as The Grand Poohbah. When The Grand Poohbah casts any Vote FOR a Proposal, that Vote counts as two Votes FOR that Proposal. The Office of Grand Poohbah passes to the Player who has cast the most Votes FOR all Proposals in the previous Week. Should there be more than one Player who meets these conditions, the Office remains with the current Player. The first holder of the Office of Grand Poohbah shall be determined in accordance with this Rule. Should more than one Player meet these conditions, the first hold shall be the Player who proposed this Rule. This paragraph shall be struck from the text of this Rule upon enactment. ----------------------------------------------------------------------- ------ Proposal 018 - Some Like It Hot The Temperature of Genomic is expressed as a positive integer number of units known as Kelvs. For each Proposal that is enacted as a Rule, the Temperature shall decrease by 1 Kelv. For each Proposal that is not enacted, the Temperature shall increase by 1 Kelv. The initial Temperature shall be set at 280 plus the Rule Number assigned to this Proposal when it is enacted. This paragraph shall be struck from the text of this Rule upon enactment. ----------------------------------------------------------------------- ------ Proposal 019 - Climatic Conditions Genomic shall have a Climate State that describes the Temperature. Should the Temperature of Genomic ever be less than 273 Kelvs, the Climate State is that of an Ice Age. In this state, a Proposal must receive an 80% majority of Votes to be enacted. Should the Temperature of Genomic ever be greater than 373 Kelvs, the Climate State is that of a Flare Period. In this state, a Proposal that receives 20% or greater Votes FOR shall be enacted. Should the Temperature of Genomic meet neither of these conditions, the Climate State is that of Temperate. ----------------------------------------------------------------------- ------ Proposal 020 - No Comment? Add the following paragraph to Rule 5 (Proposals):- Players may include comments in their Proposals. Any text contained within curly braces - "{}" - shall be ignored, as shall the braces themselves, when the Proposal containing them passes. (The Speaker may add comments to any Proposal before distributing it, signifying such by including the string "Speaker's Comments" in said comments.) Strictly speaking we can do comments already, since the paragraph you're reading now doesn't affect the ruleset at all and isn't part of a section to enact, but it'd be handy to have a formal system for it. And a way for the Speaker to add any comments he or she feels to be necessary ("Remember, because this Proposal was made by a Vegetarian, Players will lose Aubergine Points if they vote AGAINST it.", or whatever). ----------------------------------------------------------------------- ------ Proposal 021 - Survival of the Fittest If the Proposal "Gene Genie" did not pass, this Proposal shall have no effect. Enact a new Rule, "Natural Selection (and the Wine List, Please)":- A Player may attempt to Eat another Player by declaring this desire on the mailing list in a message with the subject line "Eating " (where "" is the name of any other Player), unless the Eating Player has Eaten another Player already this Week. (Players may not Eat other Players during the Interregnum.) When a Player successfully Eats another Player, the eaten Player dies and is replaced by one of his or her offspring. This is represented by three randomly-chosen genes of the eaten Player being randomised by the Speaker. In addition, the eating Player may assume one of the traits of the eaten Player; he or she should nominate a Gene number - that Gene in the eating Player is set to what it was in the Eaten Player (prior to being Eaten). Enact a new Rule, "How Not To Be Eaten":- The following restrictions apply to eating other Players. Attempts to Eat an uneatable Player shall result in the uneaten Player Eating the attempted-Eating Player instead (even if this would not normally be possible). * Huge Players may not be Eaten by Tiny or Small Players. * Players with Wings may not be Eaten by Players without Wings. * Players with Eyes may not be Eaten by Players without Eyes. * Players with Eyes and four Legs may not be Eaten by Players with two, six or no Legs. * Players with Eyes and Huge Pointy Teeth may not be Eaten by Players without Huge Pointy Teeth. (This could - and maybe even *should* - develop into a more chance-based, combat-oriented system of resolution. Maybe time to propose some defensive evolutionary tricks.) ----------------------------------------------------------------------- ------ Proposal 022 - Does somebody need a hug? There exists a game entity known as the Teddy Bear. The Teddy Bear is an eligible voter, but not a player. Whenever the Teddy Bear may vote, it votes the same as the newest player. ----------------------------------------------------------------------- ------ Proposal 023 - Oopps For the purpose of this rule an error is defined as a misspelled word, unintended word, missing punctuation, incorrect reference, or incorrect numeral in a rule or proposal. Any player may post to the official mailing list a list of errors and corrections to be made. If no player objects to this list within one week, or each active player post an agreement with the list, then the corrections shall be made to the rule or proposal. ----------------------------------------------------------------------- ------ Proposal 024 - Sludge and Pinkness Sludge is a player attribute. Each Player begins the game with 20 sludge. Players that enter the game after it has officially started receive 20 sludge. A Player may transfer sludge from one Player, hereafter known as the Victim, to another player, hereafter known as the Recipient. Sludge may only be transferred between Players in the amount of one unit per transfer. Each Player may make only one sludge transfer per turn. Players possessing less than five (5) sludge must be referred to in all list correspondence as a "pink," or some variation thereof. [[E.g., Joe is a pink.]] Only Players may possess sludge. ----------------------------------------------------------------------- ------ Proposal 025 - Rule Recombination Enact a new rule: Define a Promoter to be a clause (not necessarily a complete sentence) beginning with the word "if" Define a Repressor to be a clause (not necessarily a complete sentence) beginning with the word "unless" At the end of each Interregnum, the Speaker shall randomly select from within the Ruleset: A Promoter (hereafter referred to as P$) A Repressor (hereafter referred to as R$) A paragraph (hereafter referred to as Q$) If no Promoters or Repressors exist within the Ruleset, the Speaker shall set P$ or R$ respectively to be the empty string. A Rule will then be enacted, with the title 'Mutant Embryo #N' where N is the number of the current Interregnum, and the following text "P$, Q$, R$ This rule shall not affect play until the end of Interregnum (N+1), at which point this sentence will delete itself"" (This is a rule-generating rule, hopefully it's clear where the rule-within-the-rule begins and ends) ----------------------------------------------------------------------- ------ Proposal 026 - Mutate or Die Enact a new Rule: "If, at the end of an Interregnum, no existing Rules have been repealed or modified during that Interregnum, then the Rule with the highest number less than the number of this Rule shall be repealed." (i.e. if no existing rules are modified, this rule will start to chew away at the initial ruleset -ouch!) ----------------------------------------------------------------------- ------ Proposal 027 - Out of the Pond Scum Enact a new Rule "At the end of each Interregnum, the Player who submitted the least number of Proposals during the previous week may add up to two words to the last paragraph of this Rule. (If two or more Players have submitted the least number of Proposals, one shall be chosen randomly by the Speaker) If " (A disincentive to make proposals ? - Survival of the Unfittest??) ----------------------------------------------------------------------- ------ Proposal 028 - God does not Play at Dice Enact a new Rule "Replace all the words 'at random' and 'randomly' in all other Rules with 'at the Speaker's discretion'" (Come on, we've got no way of proving that the Speaker's decisions are random or not in the first place!) ----------------------------------------------------------------------- ------ Proposal 029 - Tree of Life Any Player may nominate another Player as being responsible for their joining the game of Genomic, if they haven't made such a nomination already. A graphical representation of such data shall be placed on the Genomic Web page, with as much beauty and complexity as the Speaker can be bothered with. Players who have not nominated another Player in this fashion are known as Missing Links (with the exception of Kevan, Genomic-founder). ----------------------------------------------------------------------- ------ Proposal 030 - Mysterious Synthesizer Blueprints There exists a unique set of Blueprints for what appears to be a Moog Synthesizer. To understand the Blueprints entirely (and thus be able to build the Moog) requires several constraints to be satisfied: 1. The player must possess Knowledge of Electronics. 2. The player must possess a Radio Shack Electronics Hobby Kit. 3. The player must possess the Blueprints. The location of the Blueprints is unknown. ----------------------------------------------------------------------- ------ Proposal 031 - Cereal Box Tops There exists an object, the Cereal Box Top, of which a player may collect any number. A player is awarded one (1) Cereal Box Top whenever he or she proposes a rule. A player is awarded one (1) Cereal Box Top whenever a proposal by that player is successfully voted in. A player may spend ten (10) Cereal Box Tops in exchange for an additional vote for or against the proposal of that player's choice. A player may spend fifty (50) Cereal Box Tops for a Space Ghost Decoder Ring. ----------------------------------------------------------------------- ------ Proposal 032 - Towers of Law There exists a foundation for an office building known as The Tower of Law (The Tower). For each proposal that is successfully voted in, a new floor is added to the top of The Tower, belonging to the proposing player. Each floor has one large window. Only the owner of a floor may open or close this window. A player may hurl his/herself from the open window of any floor they own, and from there may do one of the following: fall to the ground, or zip into an open window of a lower floor. There is an elevator in The Tower that allows a player access to any floor owned by that player. ----------------------------------------------------------------------- ------ From Mon Mar 20 06:21:43 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 14:21:58 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 31972 invoked from network); 20 Mar 2000 14:21:56 -0000 Received: from oe8.law7.hotmail.com (HELO hotmail.com) (216.33.236.112) by qg.egroups.com with SMTP; 20 Mar 2000 14:21:56 -0000 Received: (qmail 73970 invoked by uid 65534); 20 Mar 2000 14:21:56 -0000 Message-ID: <20000320142156.73969.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b57rg$rre8@e...> Date: Mon, 20 Mar 2000 14:13:27 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Tyrannids... MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_004A_01BF9276.765BB0E0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_004A_01BF9276.765BB0E0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable ----------------------------------------------------------------------- ------ Proposal 012 - The Tyrannids Are Coming! Amend Rule 2 - Players and the Speaker - preceding "If the Speaker chooses to accept this application, that person becomes a Player." with "The Speaker may choose to accept an application, on the condition that all references to the Player, in their own application, begin with a capital letter. (Such references include "I" or their name)." ----------------------------------------------------------------------- ------ Are these the same Tyrannids I recall from my younger days playing Warhamme= r 40k? Is this perhaps just a dig at proper capitalisation? = ------=_NextPart_000_004A_01BF9276.765BB0E0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
-----------------------------------------------------------=
------------
------

Proposal 012 - The Tyrannids Are Coming!

Amend Rule 2 - Players and the Speaker - preceding

"If the Speaker chooses to accept this application, that person
becomes
a Player."

with

"The Speaker may choose to accept an application, on the condition
that
all references to the Player, in their own application, begin with a
capital letter. (Such references include "I" or their name)."

-----------------------------------------------------------------------
------

Are these the same Tyrannids I recall from my younger days playi=
ng Warhammer 40k?
 
Is this perhaps just a dig at =
proper capitalisation?
------=_NextPart_000_004A_01BF9276.765BB0E0-- From Mon Mar 20 06:38:58 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 14:39:13 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 31271 invoked from network); 20 Mar 2000 14:39:11 -0000 Received: from oe29.law7.hotmail.com (HELO hotmail.com) (216.33.236.249) by qh.egroups.com with SMTP; 20 Mar 2000 14:39:11 -0000 Received: (qmail 12627 invoked by uid 65534); 20 Mar 2000 14:39:11 -0000 Message-ID: <20000320143911.12626.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b57rg$rre8@e...> Date: Mon, 20 Mar 2000 14:37:42 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_008A_01BF9279.D99B6080" Content-Transfer-Encoding: 7bit ------=_NextPart_000_008A_01BF9279.D99B6080 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable ----------------------------------------------------------------------- ------ Proposal 020 - No Comment? Add the following paragraph to Rule 5 (Proposals):- Players may include comments in their Proposals. Any text contained within curly braces - "{}" - shall be ignored, as shall the braces themselves, when the Proposal containing them passes. (The Speaker may add comments to any Proposal before distributing it, signifying such by including the string "Speaker's Comments" in said comments.) Strictly speaking we can do comments already, since the paragraph you're reading now doesn't affect the ruleset at all and isn't part of a section to enact, but it'd be handy to have a formal system for it. And a way for the Speaker to add any comments he or she feels to be necessary ("Remember, because this Proposal was made by a Vegetarian, Players will lose Aubergine Points if they vote AGAINST it.", or whatever). ----------------------------------------------------------------------- ------ A word for the wise: () =3D Parentheses {} =3D French Braces [] =3D Brackets (sometimes 'square brackets') I'd personally prefer // for comments, as I gave up Pascal many years ago..= . :) ------=_NextPart_000_008A_01BF9279.D99B6080 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
-----------------------------------------------------------------------
------

Proposal 020 - No Comment?

Add the following paragraph to Rule 5 (Proposals):-

Players may include comments in their Proposals. Any text contained
within curly braces - "{}" - shall be ignored, as shall the braces
themselves, when the Proposal containing them passes. (The Speaker
may
add comments to any Proposal before distributing it, signifying such
by including the string "Speaker's Comments" in said comments.)

Strictly speaking we can do comments already, since the paragraph you're
reading now doesn't affect the ruleset at all and isn't part of a
section to enact, but it'd be handy to have a formal system for it. And
a way for the Speaker to add any comments he or she feels to be
necessary
("Remember, because this Proposal was made by a Vegetarian, Players
will lose Aubergine Points if they vote AGAINST it.", or whatever).

-----------------------------------------------------------------------
------

A word for the wise:
() =3D Parentheses
{} =
=3D French Braces
[] =3D Brackets (sometimes 'square brackets')
I'd personally prefer // for comments, as I gave up Pascal many ye=
ars ago... :)
------=_NextPart_000_008A_01BF9279.D99B6080-- From Mon Mar 20 06:43:18 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 14:43:34 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 2742 invoked from network); 20 Mar 2000 14:43:32 -0000 Received: from oe14.law7.hotmail.com (HELO hotmail.com) (216.33.236.118) by qh.egroups.com with SMTP; 20 Mar 2000 14:43:32 -0000 Received: (qmail 23252 invoked by uid 65534); 20 Mar 2000 14:43:31 -0000 Message-ID: <20000320144331.23251.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b57rg$rre8@e...> Date: Mon, 20 Mar 2000 14:42:09 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0097_01BF927A.7883EB40" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0097_01BF927A.7883EB40 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable ----------------------------------------------------------------------- ------ Proposal 029 - Tree of Life Any Player may nominate another Player as being responsible for their joining the game of Genomic, if they haven't made such a nomination already. A graphical representation of such data shall be placed on the Genomic Web page, with as much beauty and complexity as the Speaker can be bothered with. Players who have not nominated another Player in this fashion are known as Missing Links (with the exception of Kevan, Genomic-founder). ----------------------------------------------------------------------- ------ Surely, in a sense, all original players will be linked to Kevan? (ie he = is 'responsible' for all of the original players. Who wonders what power = you can have over someone who is underneath you in the tree of, erm, life..= . ------=_NextPart_000_0097_01BF927A.7883EB40 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
-----------------------------------------------------------------------
------

Proposal 029 - Tree of Life

Any Player may nominate another Player as being responsible for their
joining the game of Genomic, if they haven't made such a nomination
already. A graphical representation of such data shall be placed on
the
Genomic Web page, with as much beauty and complexity as the Speaker
can
be bothered with.

Players who have not nominated another Player in this fashion are
known
as Missing Links (with the exception of Kevan, Genomic-founder).

-----------------------------------------------------------------------
------

Surely, in a sense, all original players will be linked to Kevan? (ie he 
is 'responsible' for all of the original players. Who wonders what=
power 
you can have over someone who is underneath you in the tr=
ee of, erm, life...
------=_NextPart_000_0097_01BF927A.7883EB40-- From Mon Mar 20 07:17:19 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 15:17:34 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 12189 invoked from network); 20 Mar 2000 15:17:31 -0000 Received: from b05.egroups.com (10.1.2.184) by iqg.egroups.com with SMTP; 20 Mar 2000 15:17:31 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.16] by b05.egroups.com with NNFMP; 20 Mar 2000 15:17:31 -0000 Date: Mon, 20 Mar 2000 07:17:25 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b5fe5$b04u@e...> In-Reply-To: <20000320143911.12626.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Proposal 012 - The Tyrannids Are Coming! > > Are these the same Tyrannids I recall from my younger days playing Warhammer 40k? They were the "Tyranids", weren't they? Rather garish buggers, if memory serves. > Is this perhaps just a dig at proper capitalisation? Looks like it. No bad thing, really. > {} = French Braces Hm. Something to wear over the top of your striped jersey? > Proposal 029 - Tree of Life > >Surely, in a sense, all original players will be linked to Kevan? (ie he >is 'responsible' for all of the original players. Quite a few of them, probably, yes. I just thought it might be an interesting thing to draw (and at least a novel way of listing players on the Web page). If it turns out to be more of a shrub, and isn't particularly exciting, we can always propose to repeal it. >Who wonders what power you can have over someone who is underneath you >in the tree of, erm, life... Drop apples on them, maybe? I wasn't really aiming for a "power" thing, just a representation of how everyone joined (and who's playing). Proper comment on the rest of the Proposals when I've got more of a moment available, anyway. Kevan -- kevan@s... http://www.stormloader.com/kevan From Pulp Mon Mar 20 07:24:26 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 15:24:42 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 25106 invoked from network); 20 Mar 2000 15:24:39 -0000 Received: from smtp.wpi.edu (130.215.24.62) by mx3.egroups.com with SMTP; 20 Mar 2000 15:24:39 -0000 Received: from reno.WPI.EDU (root@r... [130.215.24.65]) by smtp.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2KFObo02238 for ; Mon, 20 Mar 2000 10:24:37 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by reno.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2KFQue30446 for ; Mon, 20 Mar 2000 10:26:56 -0500 (EST) Date: Mon, 20 Mar 2000 10:26:56 -0500 (EST) From: Pulp To: genomic@egroups.com In-Reply-To: <20000320120132.9792.qmail@h...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further adventures in introduction. MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > Sounds like 'Cluedo' .... (or 'Clue' for Americans....) > > Adam I don't know if "Gosh, them furrin' countries is strange, thar" messages are annoying, but I have to wonder if "Cluedo" is a meaningful word that just isn't in use in the States, or if it's more of a nonsense word. I suppose it could be just some odd mushing-together of "clue" and "do" in a way not inconsistent with the rather silly names boardgames often earn, but I'm curious if there is something more to it. Yank Yank Yank, Josh Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From Mon Mar 20 07:36:00 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 15:36:15 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 12870 invoked from network); 20 Mar 2000 15:36:13 -0000 Received: from oe50.law7.hotmail.com (HELO hotmail.com) (216.33.236.86) by qh.egroups.com with SMTP; 20 Mar 2000 15:36:13 -0000 Received: (qmail 82965 invoked by uid 65534); 20 Mar 2000 15:36:13 -0000 Message-ID: <20000320153613.82964.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b5fe5$b04u@e...> Date: Mon, 20 Mar 2000 15:34:41 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_001C_01BF9281.CF79DD90" Content-Transfer-Encoding: 7bit ------=_NextPart_000_001C_01BF9281.CF79DD90 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Proposal 012 - The Tyrannids Are Coming! > > Are these the same Tyrannids I recall from my younger days playing Warhammer 40k? They were the "Tyranids", weren't they? Rather garish buggers, if memory serves. Well, it all depends what colour you painted them! I always found that a = wash of rotting flesh and Go-Fasta Red went down well. . . . . . . . . . . I'll get me coat. > Is this perhaps just a dig at proper capitalisation? = Looks like it. No bad thing, really. wHaT n0 haX0R sp33k ? = Good :) > {} =3D French Braces Hm. Something to wear over the top of your striped jersey? "All players must wear french styled clothing whilst reading, submitting,= or voting upon proposals" = *chuckle* > Proposal 029 - Tree of Life > >Surely, in a sense, all original players will be linked to Kevan? (ie he = >is 'responsible' for all of the original players. Quite a few of them, probably, yes. I just thought it might be an interesting thing to draw (and at least a novel way of listing players on the Web page). If it turns out to be more of a shrub, and isn't particularly exciting, we can always propose to repeal it. "The shrub of life" :) More sort of a starfish with some form of skin disease, I'd imagine. You = could even generate it automatically, with each branch starting as a differ= ent colour, and getting darker towards the edge. *gets carried away* >Who wonders what power you can have over someone who is underneath you >in the tree of, erm, life... Drop apples on them, maybe? I wasn't really aiming for a "power" thing, just a representation of how everyone joined (and who's playing). Even so, I rather like the idea. There's a lot of ideas that can bracnh (= pun intended, sorry) from this... at the very simplest, you could gain a vo= te for each player underneath you (speaker aside, of course), which you can= distribute as you wish... hmmm... Proper comment on the rest of the Proposals when I've got more of a moment available, anyway. Surely several moments? How long *is* a moment anyway? = *gets back to looking like he's working* Adam ------=_NextPart_000_001C_01BF9281.CF79DD90 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
 
> Proposal 012 - The Tyrannids Are Coming!
>
> Are th= ese = the same Tyrannids I recall from my younger days playing
Warhammer = 40k?

They were the "Tyranids", weren't they?= Rather = garish buggers, if
memory serves.
 
Well, it all depends what colour you painted them! I = always = found that a wash of rotting flesh and Go-Fasta Red went down = well.
.
.
.
.
.
.
.
.
.
.
I'll get me coat.
> Is = this perhaps just a dig at proper capitalisation?

Looks like it. No bad thing, really.
 
wHaT n0 haX0R sp33k ?
 
 
Good :)

> {} = =3D French = Braces

Hm. Something to wear over the top of= your = striped jersey?
"All players must wear french styled clothing whilst = reading, submitting, or voting upon proposals"
*chuckle*

> Proposal 029 - Tree of = Life
>
>Surely, in a sense, all original players will be link= ed to = Kevan? (ie
he
>is 'responsible' for all of the original = players.

Quite a few o= f them, = probably, yes. I just thought it might be an
interesting thing to draw= (and = at least a novel way of listing players
on the Web page). If it turns = out = to be more of a shrub, and isn't
particularly exciting, we can always = propose to repeal it.
"The shrub of life" :)
 
More sort of a starfish with some form of skin diseas= e, I'd = imagine. You could even generate it automatically, with each branch start= ing = as a different colour, and getting darker towards the edge. *gets carried= = away*

>Who wonders what= power = you can have over someone who is underneath you
>in the tree of, er= m, = life...

Drop apples on= them, = maybe? I wasn't really aiming for a "power" thing,
just a representati= on of = how everyone joined (and who's playing).
 
Even so, I rather like the idea. There's a lot of ide= as that = can bracnh (pun intended, sorry) from this... at the very simplest, you c= ould = gain a vote for each player underneath you (speaker aside, of course), wh= ich = you can distribute as you wish... hmmm...

Proper comment on= the = rest of the Proposals when I've got more of a
moment available, = anyway.

Surely several moments? How long *is* a mom= ent = anyway?
 
*gets back to looking like he's working*
 
Adam
------=_NextPart_000_001C_01BF9281.CF79DD90-- From Mon Mar 20 07:40:24 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 15:40:40 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 17000 invoked from network); 20 Mar 2000 15:40:37 -0000 Received: from oe5.law7.hotmail.com (HELO hotmail.com) (216.33.236.109) by qh.egroups.com with SMTP; 20 Mar 2000 15:40:37 -0000 Received: (qmail 82364 invoked by uid 65534); 20 Mar 2000 15:40:37 -0000 Message-ID: <20000320154037.82363.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: Date: Mon, 20 Mar 2000 15:38:49 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit > Sounds like 'Cluedo' .... (or 'Clue' for Americans....) > > Adam >I don't know if "Gosh, them furrin' countries is strange, thar" messages >are annoying, Think of it more as a study into the difference between cultures. >but I have to wonder if "Cluedo" is a meaningful word that >just isn't in use in the States, or if it's more of a nonsense word. I >suppose it could be just some odd mushing-together of "clue" and "do" in a Then why aren't both games called Cluedo? Maybe a dig at Americans' (sorry, AVERAGE Americans, of which I'm sure we have none :) intelligence - "I don't know what a 'cluedo' is..." ? >way not inconsistent with the rather silly names boardgames often earn, >but I'm curious if there is something more to it. Hmm. Interesting point. The film was callled 'clue', but the board game has been out for decades (Monopoly first came out in the 30's, uhm, I think).. Was it a Milton Bradley game? might be worth a look-see around their website... From Mon Mar 20 07:54:54 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 15:55:09 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 28502 invoked from network); 20 Mar 2000 15:55:07 -0000 Received: from mw.egroups.com (10.1.2.2) by iqh.egroups.com with SMTP; 20 Mar 2000 15:55:07 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.130] by mw.egroups.com with NNFMP; 20 Mar 2000 15:55:07 -0000 Date: Mon, 20 Mar 2000 07:55:00 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b5hkk$mpfq@e...> In-Reply-To: <20000320154037.82363.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > >but I have to wonder if "Cluedo" is a meaningful word that > >just isn't in use in the States, or if it's more of a nonsense word. I > >suppose it could be just some odd mushing-together of "clue" and "do" in a A mushing together, I presume, of "clue" and "ludo" ("lew-doh", although maybe you have this one in America as well), the latter being an insanely skill-less "roll dice and move counters around the board" sort of game, and Latin for - I hazard - "I play". > >way not inconsistent with the rather silly names boardgames often earn, > >but I'm curious if there is something more to it. > > Hmm. Interesting point. The film was callled 'clue', but the board game has > been out for decades (Monopoly first came out in the 30's, uhm, I think).. The film (Tim Curry as Mr Black, yes?) was American, though, I'd expect. The board game itself had its fiftieth anniversary edition quite recently, I think. > Was it a Milton Bradley game? might be worth a look-see around their > website... Hmm, www.cluedo.com says "Hasbro", but I think Hasbro own everything these days. Bludgeoning Raven with the lead piping, Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 20 08:13:57 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 16:14:11 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 27616 invoked from network); 20 Mar 2000 16:14:05 -0000 Received: from oe40.law7.hotmail.com (HELO hotmail.com) (216.33.236.35) by qg.egroups.com with SMTP; 20 Mar 2000 16:14:05 -0000 Received: (qmail 30809 invoked by uid 65534); 20 Mar 2000 16:14:05 -0000 Message-ID: <20000320161405.30808.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b5hkk$mpfq@e...> Date: Mon, 20 Mar 2000 16:12:49 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_001C_01BF9287.234296B0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_001C_01BF9287.234296B0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > >but I have to wonder if "Cluedo" is a meaningful word that > >just isn't in use in the States, or if it's more of a nonsense word. I > >suppose it could be just some odd mushing-together of "clue" and "do" in a A mushing together, I presume, of "clue" and "ludo" ("lew-doh", although maybe you have this one in America as well), the latter being an insanely skill-less "roll dice and move counters around the board" sort of game, = No matter HOW hard I tried, I could NOT explain to this to my mum. Snakes= and Ladders is the same. = You might as well just automate it and sit down and watch it. (which woul= d be amusing for, well, at leat 90 seconds) and Latin for - I hazard - "I play". You made that up :) > >way not inconsistent with the rather silly names boardgames often earn, > >but I'm curious if there is something more to it. > = > Hmm. Interesting point. The film was callled 'clue', but the board game has > been out for decades (Monopoly first came out in the 30's, uhm, I think).. The film (Tim Curry as Mr Black, yes?) was American, though, I'd expect. The board game itself had its fiftieth anniversary edition quite recently, I think. The film was definitely American :) but one of the funnier films I recall= watching. Then again, anything with Tim Curry in it tends to be good :) > Was it a Milton Bradley game? might be worth a look-see around their > website... Hmm, www.cluedo.com says "Hasbro", but I think Hasbro own everything these days. I have a worrying feeling that you could be right.... www.clue.com is unl= ikely to hold anything except clues...hah...ok, nm, I need more sleep :) Bludgeoning Raven with the lead piping, Ahh, but *where* ? ------=_NextPart_000_001C_01BF9287.234296B0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
 
> >but I have to wonder if "Cluedo" is a meaningful word = that
> >just isn't in use in the States, or if it's more of a = nonsense word.
I
> >suppose it could be just some odd = mushing-together of "clue" and
"do" in a

= A = mushing together, I presume, of "clue" and "ludo" ("lew-doh",
although= = maybe you have this one in America as well), the latter being
an insan= ely = skill-less "roll dice and move counters around the board"
sort of game= , =
 
No matter HOW hard I tried, I could NOT explain to th= is to = my mum. Snakes and Ladders is the same.
You might as well just automate it and sit down and w= atch = it. (which would be amusing for, well, at leat 90 seconds)
 
and Latin for - I hazard - "I play".
 
You made that up :)

> >way not = inconsistent with the rather silly names boardgames often
earn,
>= ; = >but I'm curious if there is something more to it.
>
> Hm= m. = Interesting point. The film was callled 'clue', but the board
game = has
> been out for decades (Monopoly first came out in the 30's, uh= m, = I
think)..

The film (Tim Curry as Mr Black, yes?) was American,= = though, I'd
expect. The board game itself had its fiftieth anniversary= = edition
quite recently, I think.
 
The film was definitely American :) but one of the fu= nnier = films I recall watching. Then again, anything with Tim Curry in it tends = to be = good :)

> Was it a Milton Bradley game? might be worth a= = look-see around their
> website...

Hmm= , = www.cluedo.com says "Hasbro", but I think Hasbro own everything
these = days.
I have a worrying feeling that you could be right....= www.clue.com is unlikely to hold anythin= g = except clues...hah...ok, nm, I need more sleep :)

Bludgeoning Raven with the lead piping,
Ahh, but *where* ?
------=_NextPart_000_001C_01BF9287.234296B0-- From Mon Mar 20 08:29:56 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 16:30:12 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 9346 invoked from network); 20 Mar 2000 16:30:10 -0000 Received: from mo.egroups.com (10.1.1.34) by iqg.egroups.com with SMTP; 20 Mar 2000 16:30:10 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.5] by mo.egroups.com with NNFMP; 20 Mar 2000 16:30:10 -0000 Date: Mon, 20 Mar 2000 08:30:09 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b5jmh$rjng@e...> In-Reply-To: <20000320161405.30808.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > No matter HOW hard I tried, I could NOT explain to this to my mum. Snakes and Ladders is the same. > You might as well just automate it and sit down and watch it. (which would be amusing for, well, at leat 90 seconds) Still annoying when you lose, though. "Damn it, I'm just not good enough at rolling these dice." I must sort out a decent random-thing generation for Genomic, actually. Some Nomics favour an email-based dice server (player mails server asking for 'x' random numbers between 1 and 'y', and the dice server mails the mailing list with the results), but I fear that's just going to be infuriating for a dozen or so 23-character DNA strings, should that proposal pass. Do you all trust me enough for me to make my own rolls in private and just inform you of the results? (Proposal 028 probably has the right idea, but it should really be aiming for "generated randomly at the Speaker's discretion", or something. I wouldn't want people to feel I had potentially unlimited power of whim on dice rolls.) > and Latin for - I hazard - "I play". > > You made that up :) It's true, actually, looking it up. Or at least a few other people think it's true. > Bludgeoning Raven with the lead piping, > > Ahh, but *where* ? Back of the head. Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 20 08:39:38 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 16:39:54 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 2244 invoked from network); 20 Mar 2000 16:39:52 -0000 Received: from mo.egroups.com (10.1.1.34) by iqh.egroups.com with SMTP; 20 Mar 2000 16:39:52 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.26] by mo.egroups.com with NNFMP; 20 Mar 2000 16:39:52 -0000 Date: Mon, 20 Mar 2000 08:39:48 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b5k8k$in9v@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] More Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit (I managed to do the back-of-the-sofa thing with four of this Week's Proposals, I'm afraid. Not the most promising of starts to a new Nomic. The following Proposals have been added to the list on the Web page, and should be Voted on as if I'd distributed them along with the rest as I was supposed to. Tch.) ----------------------------------------------------------------------- ------ Proposal 033 - Rule 4 Addendum: Up-To-Two-weeks-Long Game Weeks The Interregnum shall last no more than one (1) week. ----------------------------------------------------------------------- ------ Proposal 034 - Rule 4 Change: Exactly One-week-Long Game Weeks All Votes and Proposals must be received by Friday at 1pm. Any Proposals received after 1pm will be postponed for voting until the following Week, and any Votes received after 1pm will be discarded. The Interregnum shall consist of the subsequent weekend, until Monday at 1pm, at which time a new Week begins. The Speaker thus has exactly 72 hours to do the appropriate paperwork. ----------------------------------------------------------------------- ------ Proposal 035 - Rule 6 Addendum: Default PASS vote The default Vote for a player is "PASS". Thus a player who does not cast a Vote is equivalent to that same player explicitly casting a vote of "PASS". ----------------------------------------------------------------------- ------ Proposal 036 - Rule 6 Change: Anonymonity and Claritierness Rule 6 will be changed to read: "At the start of a given Week, the Speaker distributes a list of anonymous Proposals, to be voted upon during the coming Week. Each player may cast one (1) Vote for each Proposal on this list, and this Vote may be either "FOR", "AGAINST", or "PASS". ----------------------------------------------------------------------- ------ From Pulp Mon Mar 20 09:29:50 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by q6; 20 Mar 2000 17:30:05 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 16400 invoked from network); 20 Mar 2000 17:29:29 -0000 Received: from smtp.wpi.edu (130.215.24.62) by mx3.egroups.com with SMTP; 20 Mar 2000 17:29:29 -0000 Received: from reno.WPI.EDU (root@r... [130.215.24.65]) by smtp.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2KHTQo01866 for ; Mon, 20 Mar 2000 12:29:27 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by reno.WPI.EDU (8.10.0/8.10.0) with ESMTP id e2KHVke15246 for ; Mon, 20 Mar 2000 12:31:46 -0500 (EST) Date: Mon, 20 Mar 2000 12:31:46 -0500 (EST) From: Pulp To: genomic@e... In-Reply-To: <8b5hkk$mpfq@e...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > A mushing together, I presume, of "clue" and "ludo" ("lew-doh", > although maybe you have this one in America as well), the latter being > an insanely skill-less "roll dice and move counters around the board" > sort of game, and Latin for - I hazard - "I play". Hmm. I seem to remember the Big Dim and Friendly beastie from the movie "Labyrinth" (David Bowie, various muppets, late-80s) being named Ludo. Interesting. > > been out for decades (Monopoly first came out in the 30's, uhm, I > think).. That's sounds right. "Hey there, Broke And Depressed American, how would you like to pretend for a moment that you're precisely the sort of deranged and megalomaniacal tycoon that helped destroy the economy? Well, has Milton Bradley ever got the game for you!" > The film (Tim Curry as Mr Black, yes?) was American, though, I'd I thought Tim Curry played The Butler, and Mr. Black was the sleazy fellow who mysteriously snuffed it in the first 15 minutes. But perhaps I'm forgetting (one of) the ending(s). > expect. The board game itself had its fiftieth anniversary edition > quite recently, I think. Ah, that sounds familiar. I was desperately hunting for a copy of the word-game Balderdash this last week (unsuccessfully, at that; Balderdash seems to have been put to pasture, replaced by the watered-down rehash Beyond Balderdash, which I eventually caved in and bought) and saw the Anniversary Edition of Clue on the shelf. Don't remember it saying 50th, but I also don't remember it *not* saying 50th, so there you go. :) > Hmm, www.cluedo.com says "Hasbro", but I think Hasbro own everything > these days. > Bludgeoning Raven with the lead piping, Ah, the classic story of an American Indian plumber. I remember the first time I read Bludgeoning Raven's story, how I was immersed in the details of the lawsuit over his not switching to plastic or steel or copper, the manifestation of his insulted rage in a pipework manifesto that scrawled itself through the New York subway system... Pulp Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From RavenBlack Mon Mar 20 09:46:59 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 17:47:14 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 31119 invoked from network); 20 Mar 2000 17:47:12 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qh.egroups.com with SMTP; 20 Mar 2000 17:47:12 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12X6Gl-00044s-00 for genomic@egroups.com; Mon, 20 Mar 2000 12:47:11 -0500 Message-Id: <3.0.2.32.20000320124235.0324b8c8@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 20 Mar 2000 12:42:35 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <20000320161405.30808.qmail@h...> References: <8b5hkk$mpfq@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >>an insanely skill-less "roll dice and move counters around the >>board" sort of game, >No matter HOW hard I tried, I could NOT explain to >this to my mum. Snakes and Ladders is the same. I object. Snakes and Ladders is significantly worse than Ludo. In Ludo you have a choice of which piece to move, after rolling the dice. In S+L you never have any decisions to make. Ludo has almost the skill level of Backgammon. (Which is to say, still not very much) >>>Bludgeoning Raven with the lead piping, >>Ahh, but *where* ? >Back of the head. Er. Ow? That was uncalled for. Either that or it was called for somewhere where I couldn't hear. Which would make sense I suppose. It would be foolish to call for someone hitting me in the back of the head with a lead pipe where I could hear - I'd turn around and it would all be ruined. --RavenBlack raven@r... ICQ 3105892 http://www.ravenblack.net/ Warning : consumption of alcohol may cause you to think you are whispering when you are not. From Paul Swanson Mon Mar 20 10:54:56 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 18:55:11 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 24921 invoked from network); 20 Mar 2000 18:55:10 -0000 Received: from pianosa.catch22.org (209.157.133.196) by qh.egroups.com with SMTP; 20 Mar 2000 18:55:10 -0000 Received: by pianosa.catch22.org (Postfix, from userid 1062) id E58241772; Mon, 20 Mar 2000 10:55:09 -0800 (PST) Received: from localhost (localhost [127.0.0.1]) by pianosa.catch22.org (Postfix) with ESMTP id CC3422F5C for ; Mon, 20 Mar 2000 10:55:09 -0800 (PST) Date: Mon, 20 Mar 2000 10:55:09 -0800 (PST) From: Paul Swanson To: genomic@egroups.com In-Reply-To: <8b57rg$rre8@e...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit greetings fellow genomic players, i was reviewing the proposals, taking notes, and choosing a preliminary vote, and it occurred to me that you all might be interested in how i'm thinking of voting before i do, in case there might be something you could say to change my mind (or something green you could line my pockets with...nah, i'm not corrupt yet). so i'm going to post my preliminary votes and notes here; please don't be offended if i had less-than-favorable things to say about your proposal. i was just trying to get a gut reaction after looking at each one objectively. fyi, the below votes sum up to 14/15/8 FOR/AGAINST/PASS. Proposal/Vote/Title/(notes) 001 FOR Your Vote can make a difference (sure why the hell not) 002 AGAINST Cash in your Chips (too long and too many counterclauses) 003 PASS Proposing is its own reward (dunno yet) 004 AGAINST Megalomaniacs Anonymous 005 AGAINST Democratica Mortis (need some recourse for cheating players) 006 AGAINST Paradox! (wordy and unnecessary) 007 FOR Statistical Analysis (although it creates more work for Speaker) 008 FOR Siamese Twins (fewer Proposals we have to dig through the better) 009 AGAINST Legalise Creationism (015 is crafted better) 010 AGAINST Game Genie (sounds like a pain in my ass) 011 FOR Data Protection Act (sure, it does make things clearer) 012 AGAINST The Tyrannids are Coming! (i used no caps in my application, and i would want my application to be accepted) 013 FOR Perls of Wisdom (automation is good) 014 FOR (it's so good, i'll give out more proposals for automation) 015 FOR Begin the Beguinne 016 FOR Tom Waits for No One (seems innocuous, and i like statistics) 017 AGAINST Grand Poohbah (queasy about extra votes) 018 AGAINST Some Like it Hot 019 AGAINST Climactic Conditions 020 FOR No Comment? (i think french braces allow smooth annotation) 021 AGAINST Survival of the Fittest (more 010 ass pain) 022 PASS Somebody need a Hug? (cute and encourages activity from new players, but could be abused) 023 FOR Oopps (i think Proposals should be able to be modified all Week) 024 PASS Sludge and Pinkness (i don't like it, but seems harmless) 025 AGAINST Rule Recombination (brain fart) 026 AGAINST Mutate or Die (automation is good, but automatic rule repealing?) 027 FOR Out of the Pond Scum (neat idea, and fewer proposals) 028 PASS God does not play at dice (ambivalent) 029 AGAINST Tree of Life (interesting, but non-integral and too much work) 030 PASS Mysterious Synthesizer Blueprints (sounds fishy) 031 PASS Cereal Box Tops (always hesitant about giving extra votes) 032 AGAINST Towers of Law (oh i don't know...i'd rather not) 033 PASS (in favor of 034) 034 FOR Exactly-one-week-long-game-weeks (game needs a heartbeat) 035 FOR Default PASS Vote (explicit equivalence of abstain and PASS) 036 FOR Anonymonity and Claritierness (rule is clear, even if title isn't) please try to change my mind; that's why i'm posting this! paul (microstoned) From RavenBlack Mon Mar 20 12:04:52 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 20:05:08 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 25976 invoked from network); 20 Mar 2000 20:05:06 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 20 Mar 2000 20:05:06 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12X8QB-0007eS-00 for genomic@egroups.com; Mon, 20 Mar 2000 15:05:05 -0500 Message-Id: <3.0.2.32.20000320150500.02ffe6e0@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 20 Mar 2000 15:05:00 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: References: <8b57rg$rre8@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >thinking of voting before i do, in case there might be >something you could say to change my mind I already threw my votes, but thought I'd comment on yours anyway. I'd throw mine at the list, but they aren't as neatly formatted as yours, and I can't be bothered to reformat. >007 FOR Statistical Analysis > (although it creates more work for Speaker) This one is mine. If either of the Perls of Wisdom (preferably the second, since the first requires too many assumptions for my liking, hence the replacement) passes, it will likely create more work for me, rather than for the Speaker. The voting code for Perls of Wisdom is already in place, so that it can come into effect immediately when (if) it gets voted in. But the code for retrieving information from the raw data isn't written yet, since that won't have to be done until a week after the system is in use anyway. So, don't worry too much for the Speaker on this one. I might even be persuaded to cause the Perl to keep track of other arbitrary information too. >008 FOR Siamese Twins (fewer Proposals we have to > dig through the better) Not to mention the fact that it prevents annoying occurrences of two Rules the same coming into effect due to dodgy voting. >012 AGAINST The Tyrannids are Coming! (i used no caps in my > application, and i would want my application to be accepted) But if this were a Rule at the time, surely you would have crafted your application appropriately? It's not _purely_ a filter for non-pedants, it's a filter for people who'll try to join a Nomic without first brushing up on the Rules. >017 AGAINST Grand Poohbah (queasy about extra votes) I agree about this, particularly since the way to hold the position is to cast most FOR votes - the wording was such that the twice-as-many-votes you cast would count to hold you firmly in the position. >024 PASS Sludge and Pinkness (i don't like it, but seems > harmless) That strikes me as a strange decision - to my eye "don't like" plus "not important" equals a negative. (-1) + 0 ? >032 AGAINST Towers of Law (oh i don't know...i'd rather not) I liked this one - it has the look of a subgame to be. It reminded me, to a degree, of "Icetowers". (related in some way to the aforementioned Icehouse) >035 FOR Default PASS Vote (explicit equivalence of > abstain and PASS) I went against this one - equivalence in terms of effect is fair enough, but total equivalence makes it look as though Players are acting when they're actually dead. Besides, it would conflict with Statistical Analysis, which specifies that not responding is different from specifying PASS. --RavenBlack From Mon Mar 20 13:51:22 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 21:51:38 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 6000 invoked from network); 20 Mar 2000 21:51:35 -0000 Received: from fh.egroups.com (10.1.2.135) by iqh.egroups.com with SMTP; 20 Mar 2000 21:51:35 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.16] by fh.egroups.com with NNFMP; 20 Mar 2000 21:51:34 -0000 Date: Mon, 20 Mar 2000 13:51:30 -0800 From: "Oloros" To: genomic@e... Message-ID: <8b66h2$uoto@e...> In-Reply-To: <8b5jmh$rjng@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: random generation [Ps 010, 028] MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "kevan davis" wrote: > I must sort out a decent random-thing generation for Genomic, actually. > Some Nomics favour an email-based dice server (player mails server > asking for 'x' random numbers between 1 and 'y', and the dice server > mails the mailing list with the results), but I fear that's just going > to be infuriating for a dozen or so 23-character DNA strings, should > that proposal pass. > > Do you all trust me enough for me to make my own rolls in private and > just inform you of the results? (Proposal 028 probably has the right > idea, but it should really be aiming for "generated randomly at the > Speaker's discretion", or something. I wouldn't want people to feel I > had potentially unlimited power of whim on dice rolls.) > If you cannot trust the Speaker of the Nomic, who can . . . well, I'll just threaten to introduce legislation that would allow each of us to reorder our genes once. Stay tuned for next week's episode of Capt'n Kangaroo & Mr. Green Jeans. -Oloros From Xylen Mon Mar 20 13:52:39 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 21:52:54 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 10303 invoked from network); 20 Mar 2000 21:52:52 -0000 Received: from eagle.acns.colostate.edu (129.82.100.90) by mx3.egroups.com with SMTP; 20 Mar 2000 21:52:52 -0000 Received: from yuma.ACNS.Colostate.EDU (yuma.ACNS.ColoState.EDU [129.82.100.64]) by eagle.ACNS.ColoState.EDU (AIX4.3/UCB 8.8.8/8.8.8) with ESMTP id OAA28902 for ; Mon, 20 Mar 2000 14:52:52 -0700 Received: from holly.colostate.edu (res099037.HALLS.ColoState.EDU [129.82.99.37]) by yuma.ACNS.Colostate.EDU (AIX4.3/UCB 8.8.8/8.8.8) with ESMTP id OAA77708 for ; Mon, 20 Mar 2000 14:52:51 -0700 Message-ID: <38D69DB0.4F5D41CE@h...> Date: Mon, 20 Mar 2000 14:52:48 -0700 From: Xylen X-Mailer: Mozilla 4.7 [en] (Win95; U) X-Accept-Language: en,pdf To: genomic@egroups.com References: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Paul Swanson wrote: > > greetings fellow genomic players, > > i was reviewing the proposals, taking notes, and choosing a preliminary > vote, and it occurred to me that you all might be interested in how i'm > thinking of voting before i do, Considering the number of proposals, and the interleaving of effects, it makes sense to discuss these things. I have added my comments here for discussion as well. (27 AGAINST, 9 FOR, 0 PASS) (This includes voting against my own props. I'll try not to submit props at 3 am again. :) ) > 001 FOR Your Vote can make a difference (sure why the hell not) I personally don't see what effect the new wording would have. I'm inclined to leave things as they were, unless there is a definite reason for a change. AGAINST > 002 AGAINST Cash in your Chips (too long and too many counterclauses) I agree with it being too long. I would prefer that it be broken into two separate proposals. AGAINST > 003 PASS Proposing is its own reward (dunno yet) This seems to reward success with more proposal opportunities. If a player is extremely lucky and can get a lot of props passed, then he can propose even more props the next week, with an increasing chance of even more passing. I think this could get out of hand real fast. If there was a maximum limit to the number of props, then I would vote for it. AGAINST > 004 AGAINST Megalomaniacs Anonymous Nice try to win the game at the very beginning. AGAINST > 005 AGAINST Democratica Mortis (need some recourse for cheating players) To heck with cheating. If this prop passes, mobs could form, crimes could be committed and all sorts of chaos commence. We need some sort of control. AGAINST > 006 AGAINST Paradox! (wordy and unnecessary) I agree. AGAINST > 007 FOR Statistical Analysis (although it creates more work for Speaker) Seems like a good idea, and it could be used by future rules. Tracking the information could be done automatically, so the speaker isn't working that hard. FOR. > 008 FOR Siamese Twins (fewer Proposals we have to dig through the better) I think this puts too much power (and pressure) upon the Speaker. If a prop is really bad, the proposer deserves to read the comments of the players. This will aid in higher quality props in the future. AGAINST > 009 AGAINST Legalise Creationism (015 is crafted better) If we assume that 'modification' does not include deletion, then 015 would be better. However, I like the shorter rules, and to me 'modification' can include the concept of deletion. FOR > 010 AGAINST Game Genie (sounds like a pain in my ass) An interesting concept, but a little too much detail for this stage in the game. AGAINST > 011 FOR Data Protection Act (sure, it does make things clearer) This does add some protection to game data, which we will need. FOR > 012 AGAINST The Tyrannids are Coming! (i used no caps in my application, > and i would want my application to be accepted) Nitpicking is okay in some circumstances, but this is way to much. AGAINST > 013 FOR Perls of Wisdom (automation is good) This would make things much easier for the Speaker, as well as giving players two places to vote, in the event that one goes down. FOR > 014 FOR (it's so good, i'll give out more proposals for automation) Good try, but no cookie for this one. If a player makes a bad prop, he should suffer for it. Although I like this version better than the first one, I am not willing to award an extra prop to RavenBlack. AGAINST > 015 FOR Begin the Beguinne Simply put, I find this rule too long for what it does. AGAINST > 016 FOR Tom Waits for No One (seems innocuous, and i like statistics) I like it because it encourages player activity. If you don't submit a vote, you don't gain seniority. This could have some profound effects in the future. FOR > 017 AGAINST Grand Poohbah (queasy about extra votes) If there was a similar worded prop for Evil Dominator that went to the player who voted against getting extra against votes, I would vote for both of them. As it stands, I am not willing to allow lopsided voting. AGAINST. > 018 AGAINST Some Like it Hot An interesting way of tracking game activity. But what happens if the game is very active, lots of props pass, and the temperature decreases below zero? AGAINST > 019 AGAINST Climactic Conditions This does take care of my concerns about 018, but as this rule is tied to 018 for it's definitions, without mentioning 018, I cannot vote for it. AGAINST. > 020 FOR No Comment? (i think french braces allow smooth annotation) Unless there is some way to delimited comments, this can get confusing. "I meant that as a comment" "I thought it was part of the rule" I like this idea. FOR > 021 AGAINST Survival of the Fittest (more 010 ass pain) This prop isn't even interesting. Seems more like something to fill up the proposal queue. AGAINST > 022 PASS Somebody need a Hug? (cute and encourages activity from new players, but could be abused) Yes it could be abused, if there are not a lot of new players entering the game. However, after a few months, a new player needs all the help he can get to become a factor in the game, and extra votes would help. If it was modified to only last a limited amount of time, I would vote for it. AGAINST > 023 FOR Oopps (i think Proposals should be able to be modified all Week) In the event that something slips by everybody during voting, and a misspelling later turns out to be significant, it is important to be able to fix things without a new proposal. FOR > 024 PASS Sludge and Pinkness (i don't like it, but seems harmless) One more attribute, but no real effect to it. AGAINST > 025 AGAINST Rule Recombination (brain fart) I fail to see the need to randomly generate rules. With 5 props per player, and the number of players already, we don't need anymore rules, especially ones we can't control. AGAINST > 026 AGAINST Mutate or Die (automation is good, but automatic rule repealing?) This could spell disaster for the game, if a critical rule is deleted. Although it does encourage players to keep the game going, death will come too fast to be stopped. The game could get completely out of control in only a couple weeks. AGAINST > 027 FOR Out of the Pond Scum (neat idea, and fewer proposals) Oh goody. If someone decides to quit playing, they are can keep playing? Doesn't make any sense to me. AGAINST. > 028 PASS God does not play at dice (ambivalent) If the speaker choose not to do things randomly, isn't that a random choice of it's own. AGAINST. > 029 AGAINST Tree of Life (interesting, but non-integral and too much work) Anybody can make such a tree, and it still has no effect upon the gamestate. AGAINST > 030 PASS Mysterious Synthesizer Blueprints (sounds fishy) Neat idea for a sub game, but since we currently lack any mechanisms for subgames, this is a rather pointless prop. AGAINST > 031 PASS Cereal Box Tops (always hesitant about giving extra votes) Different names for things, but this is extremely similar to 003. AGAINST > 032 AGAINST Towers of Law (oh i don't know...i'd rather not) Some interesting possibilities here. Someone could get into another players floor, and possible access secret data, votes, props or whatever. Too bad there isn't enough in this prop to offer protection from unwarranted intrusion. AGAINST > 033 PASS (in favor of 034) A nice idea if the speaker is planning on vacationing, but with enough automation there is no need for this. If a vacation is needed, then let the players know, and if there are no props submitted, then the speaker gets his vacation. AGAINST. > 034 FOR Exactly-one-week-long-game-weeks (game needs a heartbeat) This keeps things simple. I know exactly when my props are due, when votes are needed, and there is no doubt about the timing of things. Although it is not specifically mentioned, I am assuming GMT. FOR. > 035 FOR Default PASS Vote (explicit equivalence of abstain and PASS) Some rules may depend upon 'casting' a vote, and this prop seems to undermine that concept. AGAINST. > 036 FOR Anonymonity and Claritierness (rule is clear, even if title isn't) Clears up some details, and it isn't overly wordy in doing it. FOR Xylen -- __^__ __^__ ( ___ )------------------------------( ___ ) | / | This message has been brought | \ | | / | to you by the language C and | \ | |___| the number F |___| (_____)------------------------------(_____) From RavenBlack Mon Mar 20 14:55:53 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 22:56:08 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 20905 invoked from network); 20 Mar 2000 22:56:07 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by mx3.egroups.com with SMTP; 20 Mar 2000 22:56:07 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12XB5i-0002iJ-00 for genomic@egroups.com; Mon, 20 Mar 2000 17:56:06 -0500 Message-Id: <3.0.2.32.20000320175607.02ffdf3c@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 20 Mar 2000 17:56:07 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <38D69DB0.4F5D41CE@h...> References: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >> 014 FOR (it's so good, i'll give out more proposals for >Good try, but no cookie for this one. If a player makes a bad >prop, he should suffer for it. Although I like this version >better than the first one, I am not willing to award an extra >prop to RavenBlack. AGAINST Hm, not really "extra", since it's replacing the one I wasted in the earlier Proposal. Seems foolish to vote for the Proposal that doesn't work, and vote against the one that does... Still, if it comes through that way, we'll see what happens when people try to Vote with the Perl interface and don't have any usernames or passwords... --RavenBlack From Mon Mar 20 15:17:37 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 20 Mar 2000 23:17:52 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 16436 invoked from network); 20 Mar 2000 23:17:51 -0000 Received: from f161.law8.hotmail.com (HELO hotmail.com) (216.33.241.161) by qg.egroups.com with SMTP; 20 Mar 2000 23:17:51 -0000 Received: (qmail 88497 invoked by uid 0); 20 Mar 2000 23:17:51 -0000 Message-ID: <20000320231751.88496.qmail@h...> Received: from 204.60.206.220 by www.hotmail.com with HTTP; Mon, 20 Mar 2000 15:17:50 PST X-Originating-IP: [204.60.206.220] From: "Tyrethali Ansrath" To: genomic@egroups.com Date: Mon, 20 Mar 2000 18:17:50 EST Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] My two cents! MIME-Version: 1.0 Content-Type: text/plain; format=flowed Content-Transfer-Encoding: 7bit Hey, all. I'm posting my thoughts on each proposal too... F means For (16 total), A means Against (20 total), and P means pass(None whatsoever). 1-F. Seems good. 2-A. Just because you can't think of more proposals doesn't mean you should get extra votes. That's what I see. 3-F. What's the worst that could happen? Someone could propose a lot of proposals, which would all suck, so the next week they were back at four? Keep in mind, to get to that point, they'd have to have The benifits outweigh the risks, imho. 4-A. I've played enough Imperial Nomics, thank you. 5-A. But how would we resolve conflicts? Maybe if you included some other way... 6-F. Even though it's aims will probably be put off by only periodic proposal checking. 7-A. We need this... why? Just seems like, at the present, pointless bookkeeping. 8-F. I almost voted down this one, but then I saw the "doesn't count against limit" bit. Okay, then. 9-F. Yes we are allowed to enact and repeal rules. Both of those are "modifications of the ruleset". But this can't hurt. I hope. 10-A. Actually, I'd prefer something like this, if it used the tree of life idea. 11-F. Seems like a minor oopsie. Although I'm worried about getting a bit too pedantry if I see many more of these types. 12-A. While I might prefer captilaztion where it is due, that shouldn't be something that's actually game-affecting. Except, perhaps, in the form of a medal. 13-A. See below. 14-F. Web-based voting is okay, but we should have passwords. 15-A. Nah. I've already voted for a good enough change to this rule. 16-A. My first impression is that this is setting up the ruleset to discriminate against new players. 17-A. Standard objections as everyone else. 18-F. I don't really see why not. Although, it might be nice if it was based, somehow, on also proposals or lack thereof. 19-A. So, I propose a bunch of crummy proposals, and suddenly they get easier to enact? Sorry. 20-F. Comments are life. Comments are power. >=) 21-F. If we do get Game Genie, might as well be able to have some fun with it. 22-A. Just as I don't like potentially giving older players an advantage, the same goes for newer. All players are equal in the eyes of the ruleset, or at least, should be. 23-F. Not a bad thing. 24-A. Define "turn" first. 25-A. Nah. I find things like this seem amusing, at first, like baby crocodiles, but then become harsh and evil things bent on destroying all you work for, like lawyers. 26-A. No. I mean, why? Messing with the core fabric of the game arbitrarily is a bad thing. See above comment. 27-A. Something like the opposite, perhaps. Maybe a sub-game, where the bestest players got to choose the rules. Hmmmm. 28-F. Here's to hoping the speaker's discretion includes dice in some manner. 29-F. Yes, even though I can't nominate myself as the person who convinced me to join, like I did in Garden Nomic. I'd like to see THAT in your diagram! I'll just hope someone nominates me, then nominate them. 30-A. Let's wait for such things as locations, entities, etc to be defined. If we are going to do that. 31-A. Really, rewarding crummy proposals? 32-F. Definite potential for a future subgame. I like it. 33-A. Because I voted yes on 34. 34-F. Because I voted no on 33. 35-A. Because they aren't equal. 36-A. Whose proposals? Clarify THAT first. And that's pretty much all. BTW, Kevan, these are my votes, for the record, on the grounds that rule 6 says "should". ;-) ______________________________________________________ From Mon Mar 20 17:21:17 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 01:21:33 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 30338 invoked from network); 21 Mar 2000 01:21:31 -0000 Received: from mo.egroups.com (10.1.1.34) by iqg.egroups.com with SMTP; 21 Mar 2000 01:21:31 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.124] by mo.egroups.com with NNFMP; 21 Mar 2000 01:21:13 -0000 Date: Mon, 20 Mar 2000 17:21:04 -0800 From: "Oloros" To: genomic@e... Message-ID: <8b6iq0$h571@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: rule change? [Ps 009, 015] MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Regards Proposals 009:Legalize Creationism and 015:Begin the Beguinne These two proposals are similiar enough that, were the Speaker so empowered, I would think that they would be concatenated before voting. Will anyone call for Judgement (under Rule 8) should any proposal be enacted or any part of the ruleset deleted? And which one of these proposals best addresses the perceived ambiguity of Rule 5 without becoming cumbersome? I must admit that I am wary of letting "gentlemens' agreements" guide us more than contracted rules, and so would rather see the more explicit Proposal 015 passed. -Oloros From Paul Swanson Mon Mar 20 21:52:10 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 05:52:25 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 3099 invoked from network); 21 Mar 2000 05:52:24 -0000 Received: from pianosa.catch22.org (209.157.133.196) by qh.egroups.com with SMTP; 21 Mar 2000 05:52:24 -0000 Received: by pianosa.catch22.org (Postfix, from userid 1062) id D12951772; Mon, 20 Mar 2000 21:52:22 -0800 (PST) Received: from localhost (localhost [127.0.0.1]) by pianosa.catch22.org (Postfix) with ESMTP id BFD992FA6 for ; Mon, 20 Mar 2000 21:52:22 -0800 (PST) Date: Mon, 20 Mar 2000 21:52:22 -0800 (PST) From: Paul Swanson To: genomic@egroups.com In-Reply-To: <3.0.2.32.20000320175607.02ffdf3c@w...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit just a bit of rebuttal on a few proposals. after i get this out i believe i'm ready to vote, which for the record i've changed to 14/18/4 FOR/AGAINST/PASS (mostly changing PASS to AGAINST after reading further comments). 007 (statistical analysis): we don't need this, but it's completely harmless and the statistics would be nice to have (and easy to keep track of, for either RavenBlack or the Speaker). i'm still voting FOR and hope this one gets passed. 009/015: i don't really care which of these gets enacted (if either), although i slightly prefer 015. the authors of these proposals should band together to create one consolidated proposal, or to convince us to all vote for one (lest neither gets passed). 013/014 (Perls of Wisdom): Proposals are cheap, and I'm willing to give out small finite numbers of them for volunteer work. i think that web-based voting is a good thing, and so i'd like to see one of these passed...preferably 014 since that gives us usernames and passwords (as RavenBlack pointed out). in any event, we should again band together and vote for one or the other, lest neither gets passed. 033/034 (length of game turns): the outspoken majority likes 034, so i'll jump on the bandwagon and give it more momentum. looking forward to the next round, paul From RavenBlack Mon Mar 20 22:31:22 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 06:31:37 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 6132 invoked from network); 21 Mar 2000 06:31:36 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 21 Mar 2000 06:31:36 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12XIBb-0003Xx-00 for genomic@egroups.com; Tue, 21 Mar 2000 01:30:40 -0500 Message-Id: <3.0.2.32.20000321013026.0311edcc@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Tue, 21 Mar 2000 01:30:26 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: References: <3.0.2.32.20000320175607.02ffdf3c@w...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >013/014 (Perls of Wisdom): Proposals are cheap, and I'm willing to > give out small finite numbers of them for volunteer work. i think > that web-based voting is a good thing, and so i'd like to see > one of these passed...preferably 014 since that gives us usernames > and passwords (as RavenBlack pointed out). in any event, we should > again band together and vote for one or the other, lest neither > get passed. Note that since 014 effectively repeals 013, voting for both won't cause trouble. (and won't even improve my statistics, since such things won't begin being collated until after this Week) I did my best to fix the fact that 013 was incomplete. And my getting one extra Proposal when that passes is unlikely to make a difference - chances are I won't be making 6 Proposals in one Week anyhow. Now if I could _retroactively_ have that one extra Proposal for overriding my messed up one, that'd be nice... Guess I should've just left the extra Proposal thing out of it, because it's an anti-incentive of sorts. Tsch. --RavenBlack From Tue Mar 21 03:18:29 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 11:18:44 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 19508 invoked from network); 21 Mar 2000 11:18:41 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqg.egroups.com with SMTP; 21 Mar 2000 11:18:41 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.15] by mv.egroups.com with NNFMP; 21 Mar 2000 11:18:41 -0000 Date: Tue, 21 Mar 2000 03:18:37 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b7lqc$49a5@e...> In-Reply-To: <8b57rg$rre8@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit >Proposal 002 - Cash in your chips I fear this would make things a bit too hard to predict, and - as said - the "free Votes if you couldn't think of any Proposals" thing seems dangerous (likewise "free Proposals if you're happy to make the voting process more unstable"). >Proposal 003 - Proposing is its own reward I can see this ballooning insanely, but I'm tempted to wave it through for now and propose a ceiling next Week. >Proposal 004 - Megalomaniacs Anonymous Amusing. Are you willing to buy votes from us, TwistedOne? >Proposal 005 - Democratica mortis Tsk. Anarchists. >Proposal 006 - Paradox! This is how I'm doing it anyway, actually. Can't hurt to clarify, though, I suppose. >Proposal 007 - Statistical Analysis Might as well keep this from the start, on the off-chance we can think of anything interesting to do with it. Not the sort of thing you want to try and introduce and calculate retroactively in Week 8. >Proposal 008 - Siamese Twins A good thing. Xylen's argument for punishing bad players by having their Proposals shot down is fair enough, but I'd rather the Voters were never forced to decide which of two very-similar Proposals they prefer (since it'd be fairly likely that both or neither would enact). And it'd be unfair if one of two perfectly *good* players had a Proposal voted down simply because someone else had proposed a *slightly* more exhaustive version. >Proposal 009 - Legalise Creationism > >We're not really allowed to enact or repeal rules yet. I think we're alright; "A Proposal is a suggested modification to the Ruleset, changing the text of any number of Rules." - there's no reason why the "any number" can't be "zero". On balance I think I prefer 015 for its clarity, anyway. >Proposal 010 - Gene Genie This is one of mine. I thought it was rather amusing; I'm not quite sure how a Web page listing players and saying things like "Raven is small, has no arms, two legs, a beak, human-style eyes and two wings. TheTwistedOne is large, has two arms, six legs, huge pointy teeth and hollow eyes." is a pain in Paul's arse, let alone anyone else's, but still. >Proposal 012 - The Tyrannids Are Coming! Unfair on people with broken shift-keys, perhaps, but as this plays on a bugbear of mine, I think I might give it the nod anyway. >Proposal 013 - Perls of Wisdom >Proposal 014 - Perls of Wisdom (2) The extra-proposal-to-make-up-for-the-lost is fair enough, I think, since Raven was kind enough to spend one of his Proposals on the latter fix. And as he says, voting FOR 013 and AGAINST 014 will just give us an automated voting booth that we can't use. >Proposal 016 - Tom Waits for No One Elegant. >Proposal 017 - The Grand Poohbah Hmm, encouraging people to vote FOR as many Proposals as possible is just going to mean more bad Proposals get through. And giving an extra-vote reward to the Player ruthless enough to cough out copious FOR votes seems strange, too. Giving such a thing to a Player who voted FOR all the Proposals that passed and AGAINST all those that failed might be saner... >Proposal 018 - Some Like It Hot >Proposal 019 - Climatic Conditions I think 019's effects are rather harsh, and could easily bog the game down (or blow it up); 018's idea is quite pleasing, though. >Proposal 022 - Does somebody need a hug? Endearing. Although I suspect that automatically doubling the voting power of the most naive Player could well be a bad thing. >Proposal 023 - Oopps "Incorrect numeral" seems dangerous (sorry, I meant to say "everyone gets *a thousand* Proposals, not three"), but the objection clause would seem to take care of it. Good stuff. >Proposal 024 - Sludge and Pinkness "One more attribute, but no real effect to it." says Xylen; surely such is the way Nomics work, though? Proposing the bare bones of something and then leaving other people to flesh it out is far better than saying "Right, here's a complete sub-game for you, off you go." One strange flaw in the Proposal, though - "Each Player may make only one sludge transfer per turn." What's a "turn"? >Proposal 025 - Rule Recombination This seems very clever and amusing, with the one-Week delay giving us a chance to beat particularly vicious mutant Rules down with a stick. I'd be disappointed if this didn't enact. >Proposal 026 - Mutate or Die Dangerous that it eats *up* through the Ruleset, rather than down, really. Too dangerous. >Proposal 027 - Out of the Pond Scum Maybe an entertaining way for idle Players to keep their hand in, I suppose. A pity more of us can't join in with it, though, without sacrificing our Proposals. >Proposal 028 - God does not Play at Dice I don't really like this, since it creates the impression that I can quite happily make random decisions at whim; I don't want to become a Paranoia GM. I'd be happier with a definition of "random" that said "randomly determined by whatever means the Speaker deems appropriate" or something, I think. >Proposal 029 - Tree of Life As Xylen says, anyone can cheerfully draw this without it having to be a Rule; fair enough, I suppose, but it means our voluntary artist polling everyone to check who recruited them. And it might be worth taking the idea further, if we get an interesting tree (or redefine its structure to make it more interesting). >Proposal 030 - Mysterious Synthesizer Blueprints Intriguing. Maybe better after we've got some sort of system for "locations" and "possessions" and "knowledge", though. >Proposal 031 - Cereal Box Tops Reasonable enough stuff, and nicely cumulative, rather than the immediacy of 003. Not sure which I'll go for. >Proposal 032 - Towers of Law Hm, intriguing. It's going to make for a fairly hefty Tower, though. And the Rule doesn't say whether windows are open or closed when a new floor is created, which isn't good. >Proposal 033 - Rule 4 Addendum: Up-To-Two-weeks-Long Game Weeks > > The Interregnum shall last no more than one (1) week. I'll have to be really careful not to be hit by buses or fall ill or go on holiday for more than a week, or anything, then. This will also be extremely awkward to work around retroactively - normally if someone breaks a Rule we can just say "Okay, that didn't happen, your attempt to drink a Possession you weren't carrying just has no effect", but in this case it'll mean mucking around with time-space causality to balance things out. Badness. >Proposal 034 - Rule 4 Change: Exactly One-week-Long Game Weeks > > All Votes and Proposals must be received by Friday at 1pm. Any Proposals > received after 1pm will be postponed for voting until the following > Week, and any Votes received after 1pm will be discarded. > > The Interregnum shall consist of the subsequent weekend, until Monday at > 1pm, at which time a new Week begins. The Speaker thus has exactly 72 > hours to do the appropriate paperwork. Again, I'll have to be careful not to be ill for more than three days, and all that. And I opted for a Monday Interregnum when I first wrote the ruleset so that people would have the weekend to do their voting and proposing, if they needed it. I think "get everything in by Monday 1pm" is a clear enough deadline, as it stands, with the Interregnum taking as long as it takes, rather than being dragged out to three days. And, personally, I'd rather not have to do all the Interregnum stuff during my weekends, to be honest. >Proposal 035 - Rule 6 Addendum: Default PASS vote As commented, this means that sleeping players will count as having voted. And this doesn't even add anything to the voting process, since proposals pass entirely on the balance of FOR/AGAINST votes - a PASS is the same as not voting at all, in that respect. We should distinguish between considered abstaining and forgetful failure-to-vote, I think. >Proposal 036 - Rule 6 Change: Anonymonity and Claritierness Perhaps fair enough to clarify that Proposal distribution is anonymous (although I'll be doing this anyway until the Ruleset says something one way or another), but it should be noted in huge, flashing red letters that - by rewording the whole of Rule 6 - this Proposal will blindly overwrite the effects of Proposals 001, 013, 014 and 035. Not a good thing. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 21 03:32:32 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 11:32:48 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 10816 invoked from network); 21 Mar 2000 11:32:42 -0000 Received: from mr.egroups.com (10.1.1.37) by iqh.egroups.com with SMTP; 21 Mar 2000 11:32:42 -0000 X-eGroups-Return: flix_os@h... Received: from [10.1.2.131] by mr.egroups.com with NNFMP; 21 Mar 2000 11:32:42 -0000 Date: Tue, 21 Mar 2000 03:32:38 -0800 From: "Gallivanting Tripper" To: genomic@e... Message-ID: <8b7mkm$80rb@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Putting my Foot in It MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Evening, all I might as well introduce myself as a devil's advocate of sorts, and with my two bits on what Genomic could/should be: Different - creative - dynamic - what does not kill it, makes it stronger. Bit #1 - Subgames If Genomic has a subgame, I favour one that is suitably novel, and suits Genomic's character, so I'm putting my weight behing the Gene Genie and its sequesl at the expense of the other (not-quite-developed) hints at subgames. Bit #2 - "Dangerous proposals" A few interesting-looking props have taken a bit of a caning on the eGroup, so I'll try to defend the best-looking ones. And for all those less conservative players out there - pat the baby crocodiles! Spice up the games for a while! In order: 017 - The Grand Poohbah : IMHO should be called the Sycophant - in order to hold onto eir office, the Poohbah has to vote FOR every proposal, and races to get the Poohbah's seat will cause a good many proposals to pass, which may be a good thing for increasing change, and creativity. It's not necessarily a powerful one=sided rule, because the Poobah's extra vote cannot be used against a proposal that limits its power. 018 and 019 - Climate Control (some like it HOT) Although someone suggested that this encourages junk proposals to overheat the system, the number of serious proposals this week suggests that the quality should remain high. And even if the system does overheat, it'll be a good test of discipline and creativity, and proposals will still need 3 votes to pass, on current numbers, so the megalomaniac danger still isn't that great. 025 - Rule Recombination While it looks like this rule has the potential to create real monsters, they won't become active until a week after they're generated, which is plenty of time for them to be aborted. And it could come up with something - interesting ! 026 - Mutate or Die Given that a high proportion of this week's proposals have been amendments, the probability that this rule will become a menace is low. And it's far enough down the proposal list that about 10 other rules will have to die before it hits the initial set (which someone is trying to repeal part of this week, indeed). It's a mechanism for ensuring there is constant change, which I support. As for the rest of the rules: support anything that you can't see immediate problems with. What kind of a game are we playing here anyway? ;-) GT From Tue Mar 21 04:50:31 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 12:50:46 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 20432 invoked from network); 21 Mar 2000 12:50:44 -0000 Received: from b05.egroups.com (10.1.2.184) by iqg.egroups.com with SMTP; 21 Mar 2000 12:50:44 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.124] by b05.egroups.com with NNFMP; 21 Mar 2000 12:50:42 -0000 Date: Tue, 21 Mar 2000 04:50:33 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b7r6p$8nf1@e...> In-Reply-To: <8b6iq0$h571@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: rule change? [Ps 009, 015] MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Will anyone call for Judgement (under Rule 8) should any proposal be > enacted or any part of the ruleset deleted? And which one of these > proposals best addresses the perceived ambiguity of Rule 5 without > becoming cumbersome? As commented in my previous message, I see no problem with "A Proposal is a suggested modification to the Ruleset, changing the text of any number of Rules." covering a repeal (modifying the ruleset, changing the text of one rule to blankness) or an enactment (modifying the ruleset, changing the text of zero rules). It is, confessedly, rather awful original wording on my part, but I think we'll live. > I must admit that I am wary of letting "gentlemens' agreements" guide > us more than contracted rules, and so would rather see the more > explicit Proposal 015 passed. I quite agree. Maybe it'd be helpful to formally propose some sort of "gentleman's agreement" scheme that allowed direct ruleset alteration on the basis of nobody objecting (and at least a couple of other Players agreeing) within a week, or something. (After all, we might need a quick way to kill unruly Rules if the mutant thing gets voted through; the 'self-evolving ruleset' aspect is very appealing, but would need a fairly sturdy set of tranquiliser guns at the ready, just in case.) Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 21 05:05:27 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 13:05:43 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 32079 invoked from network); 21 Mar 2000 13:05:42 -0000 Received: from mo.egroups.com (10.1.1.34) by iqg.egroups.com with SMTP; 21 Mar 2000 13:05:42 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.131] by mo.egroups.com with NNFMP; 21 Mar 2000 13:05:42 -0000 Date: Tue, 21 Mar 2000 05:05:34 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b7s2u$827a@e...> In-Reply-To: <20000320231751.88496.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: My two cents! (Tree of Life) MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > 29-F. Yes, even though I can't nominate myself as the person who convinced > me to join, like I did in Garden Nomic. I'd like to see THAT in your > diagram! I'll just hope someone nominates me, then nominate them. Well, I'd hoped to get away from the "lying about your recruiter for tactical reasons" thing (I seem to remember Raven and I nominating each other for recruitment bonuses in ParaNomic) by having no reward for doing so. Maybe we'd need to add "The Genomic Web Page" as a branch entity to make it halfway interesting, though. Maybe even other people's Web pages as well, if anyone's linked to it yet. Hm. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 21 05:08:40 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 13:08:55 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13248 invoked from network); 21 Mar 2000 13:08:54 -0000 Received: from oe22.law7.hotmail.com (HELO hotmail.com) (216.33.236.242) by qh.egroups.com with SMTP; 21 Mar 2000 13:08:54 -0000 Received: (qmail 317 invoked by uid 65534); 21 Mar 2000 13:08:53 -0000 Message-ID: <20000321130853.316.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b7lqc$49a5@e...> Date: Tue, 21 Mar 2000 11:51:36 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_000A_01BF932B.CF4BA060" Content-Transfer-Encoding: 7bit ------=_NextPart_000_000A_01BF932B.CF4BA060 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > All Votes and Proposals must be received by Friday at 1pm. Any Proposals > received after 1pm will be postponed for voting until the following > Week, and any Votes received after 1pm will be discarded. 1pm GMT? BST? EST? UST? Do clarify :) ------=_NextPart_000_000A_01BF932B.CF4BA060 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
> All Votes and Proposals must be received by Friday a=
t 1pm. Any
Proposals
> received after 1pm will be postponed for voting until the following
> Week, and any Votes received after 1pm will be discarded.

1pm GMT? BST? EST? UST?
 
 
<= PRE>Do clarify :)
------=_NextPart_000_000A_01BF932B.CF4BA060-- From Tue Mar 21 05:23:45 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 13:24:00 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 25709 invoked from network); 21 Mar 2000 13:23:57 -0000 Received: from oe9.law7.hotmail.com (HELO hotmail.com) (216.33.236.113) by qh.egroups.com with SMTP; 21 Mar 2000 13:23:57 -0000 Received: (qmail 20275 invoked by uid 65534); 21 Mar 2000 13:23:56 -0000 Message-ID: <20000321132356.20274.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8b7s2u$827a@e...> Date: Tue, 21 Mar 2000 13:22:37 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: My two cents! (Tree of Life) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0044_01BF9338.86517440" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0044_01BF9338.86517440 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Then perhaps a modification that states that you have to also submit a *rea= son* for the player 'recruiting' you. It seems patently obvious that two pl= ayers cannot persuade eachother to join (except in some rare cases, but, ev= en so, one of them had to have found it first) would be in order. And maybe= some more modifications. Well, we'll see if it goes through first. > 29-F. Yes, even though I can't nominate myself as the person who convinced = > me to join, like I did in Garden Nomic. I'd like to see THAT in your = > diagram! I'll just hope someone nominates me, then nominate them. Well, I'd hoped to get away from the "lying about your recruiter for tactical reasons" thing (I seem to remember Raven and I nominating each other for recruitment bonuses in ParaNomic) by having no reward for doing so. Maybe we'd need to add "The Genomic Web Page" as a branch entity to make it halfway interesting, though. Maybe even other people's Web pages as well, if anyone's linked to it yet. Hm. ------=_NextPart_000_0044_01BF9338.86517440 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Then perhaps a modification that states that you have t= o also = submit a *reason* for the player 'recruiting' you. It seems patently obviou= s = that two players cannot persuade eachother to join (except in some rare cas= es, = but, even so, one of them had to have found it first) would be in order. An= d = maybe some more modifications. Well, we'll see if it goes through = first.
 
> 29-F. Yes, even though I can'= t = nominate myself as the person who
convinced
> me to join, like = I did = in Garden Nomic. I'd like to see THAT in your
> diagram! I'll just= hope = someone nominates me, then nominate them.

Well, I'd hoped to get a= way = from the "lying about your recruiter for
tactical reasons" thing (I se= em to = remember Raven and I nominating each
other for recruitment bonuses in = ParaNomic) by having no reward for
doing so. Maybe we'd need to add "T= he = Genomic Web Page" as a branch
entity to make it halfway interesting, = though. Maybe even other
people's Web pages as well, if anyone's linke= d to = it yet. Hm.
------=_NextPart_000_0044_01BF9338.86517440-- From Paul Swanson Tue Mar 21 05:39:45 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 13:40:00 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 26016 invoked from network); 21 Mar 2000 13:39:59 -0000 Received: from pianosa.catch22.org (209.157.133.196) by mx3.egroups.com with SMTP; 21 Mar 2000 13:39:59 -0000 Received: by pianosa.catch22.org (Postfix, from userid 1062) id 3A4691772; Tue, 21 Mar 2000 05:39:59 -0800 (PST) Received: from localhost (localhost [127.0.0.1]) by pianosa.catch22.org (Postfix) with ESMTP id 28FC52FC0 for ; Tue, 21 Mar 2000 05:39:59 -0800 (PST) Date: Tue, 21 Mar 2000 05:39:58 -0800 (PST) From: Paul Swanson To: genomic@egroups.com In-Reply-To: <20000321130853.316.qmail@h...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit On Tue, 21 Mar 2000, Adam S wrote: > > All Votes and Proposals must be received by Friday at 1pm. Any > Proposals > > received after 1pm will be postponed for voting until the following > > Week, and any Votes received after 1pm will be discarded. > > 1pm GMT? BST? EST? UST? > > > Do clarify :) let's not use GMT, it's too confusing...i suggest UTC. otherwise, the rest of the rules say GMT explicitly, so i assume that would apply to this rule as well. (at least, any Judge in his right mind would rule that way). paul > > > > ------------------------------------------------------------------------ > To Post a message, send it to: genomic@e... > To Unsubscribe, send a blank message to: genomic-unsubscribe@e... > > ------------------------------------------------------------------------ > You have a voice mail message waiting for you at iHello.com: > http://click.egroups.com/1/2377/3/_/744559/_/953644135/ > > -- Easily schedule meetings and events using the group calendar! > -- http://www.egroups.com/cal?listname=genomic&m=1 > > From Paul Swanson Tue Mar 21 05:57:41 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 13:57:56 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 14474 invoked from network); 21 Mar 2000 13:57:54 -0000 Received: from pianosa.catch22.org (209.157.133.196) by qg.egroups.com with SMTP; 21 Mar 2000 13:57:54 -0000 Received: by pianosa.catch22.org (Postfix, from userid 1062) id 782661772; Tue, 21 Mar 2000 05:57:54 -0800 (PST) Received: from localhost (localhost [127.0.0.1]) by pianosa.catch22.org (Postfix) with ESMTP id 62C222FC0 for ; Tue, 21 Mar 2000 05:57:54 -0800 (PST) Date: Tue, 21 Mar 2000 05:57:54 -0800 (PST) From: Paul Swanson To: genomic@egroups.com In-Reply-To: <8b7mkm$80rb@e...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Putting my Foot in It MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit On Tue, 21 Mar 2000, Gallivanting Tripper wrote: > Evening, all > > I might as well introduce myself as a devil's advocate of sorts, and > with my two bits on what Genomic could/should be: > > Different - creative - dynamic - what does not kill it, makes it > stronger. I agree on all these points, but being a newbie to actually playing a game of Nomic, I'd like to proceed with caution. Gene Genie or Rule Recombination could be awesome additions to Genomic, but for the first few weeks I'd just like to hammer on the initial Ruleset and get to know all of you. So I guess that explains why my Proposals were all pretty dry, and why I'll be voting Against many of this week's Proposals. Maybe if they resurface after awhile...=) BTW, in rebuttal to whomever couldn't figure out why Gene Genie was a pain in my ass: My DNA is ACTGATATGTACATGATGATACAT and another player's is GTACGTTACAGTACGTACGATACA. What characteristics would our offspring have? Now, if said Proposal were accompanied by a program that easily figured such things out, I'd be more inclined to vote for it. I just don't want to have to manually calculate data based on some obscure code that is based in chemical or biological life processes. (Like, "each player is assigned a chemical formula at random. The number of Proposals that player may submit is equal to their formula's specific gravity". It's not that this Proposal wouldn't be a neat concept, just that I don't want to drag out my high-school chemistry book.) paul (p.s. caps in this message are for you, kevan) From Tue Mar 21 06:08:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 14:08:20 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 8823 invoked from network); 21 Mar 2000 14:07:54 -0000 Received: from oe6.law7.hotmail.com (HELO hotmail.com) (216.33.236.110) by mx3.egroups.com with SMTP; 21 Mar 2000 14:07:54 -0000 Received: (qmail 57743 invoked by uid 65534); 21 Mar 2000 14:07:53 -0000 Message-ID: <20000321140753.57742.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: Date: Tue, 21 Mar 2000 14:06:09 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0012_01BF933E.9B6E3650" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0012_01BF933E.9B6E3650 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > > All Votes and Proposals must be received by Friday at 1pm. Any > Proposals > > received after 1pm will be postponed for voting until the following > > Week, and any Votes received after 1pm will be discarded. > > 1pm GMT? BST? EST? UST? > > > Do clarify :) let's not use GMT, it's too confusing...i suggest UTC. otherwise, the rest of the rules say GMT explicitly, so i assume that would apply to this rule as well. (at least, any Judge in his right mind would rule that way). What on Earth is UTC? ------=_NextPart_000_0012_01BF933E.9B6E3650 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
> > All Votes and Proposals must be received by Fri=
day at 1pm. Any
> Proposals
> > received after 1pm will be postponed for voting until the follo=
wing
> > Week, and any Votes received after 1pm will be discarded.
>
> 1pm GMT? BST? EST? UST?
>
>
> Do clarify :)

let's not use GMT, it's too confusing...i suggest UTC. otherwise, the
rest of the rules say GMT explicitly, so i assume that would apply to this
rule as well. (at least, any Judge in his right mind would rule that
way).


What on Earth is UTC?
------=_NextPart_000_0012_01BF933E.9B6E3650-- From Tue Mar 21 06:08:07 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 14:08:22 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 23889 invoked from network); 21 Mar 2000 14:07:55 -0000 Received: from oe13.law7.hotmail.com (HELO hotmail.com) (216.33.236.117) by qg.egroups.com with SMTP; 21 Mar 2000 14:07:55 -0000 Received: (qmail 79225 invoked by uid 65534); 21 Mar 2000 14:07:54 -0000 Message-ID: <20000321140754.79224.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: Date: Tue, 21 Mar 2000 14:06:28 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Putting my Foot in It MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_001D_01BF933E.A6B63E40" Content-Transfer-Encoding: 7bit ------=_NextPart_000_001D_01BF933E.A6B63E40 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable paul (p.s. caps in this message are for you, kevan) Except in the words 'kevan' and 'paul' *chuckles* ------=_NextPart_000_001D_01BF933E.A6B63E40 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
paul

(p.s. caps in this message are for you, kevan)

Except in the words 'kevan' and 'paul' *chuckles*
------=_NextPart_000_001D_01BF933E.A6B63E40-- From Tue Mar 21 06:40:27 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 14:40:42 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22133 invoked from network); 21 Mar 2000 14:40:37 -0000 Received: from mr.egroups.com (10.1.1.37) by iqg.egroups.com with SMTP; 21 Mar 2000 14:40:37 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.122] by mr.egroups.com with NNFMP; 21 Mar 2000 14:40:37 -0000 Date: Tue, 21 Mar 2000 06:40:27 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8b81kr$3re3@e...> In-Reply-To: User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Putting my Foot in It MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > I agree on all these points, but being a newbie to actually playing a game > of Nomic, I'd like to proceed with caution. Gene Genie or Rule > Recombination could be awesome additions to Genomic, but for the first few > weeks I'd just like to hammer on the initial Ruleset and get to know all > of you. That's fair enough, and I wouldn't want to think we were speeding forward too quickly for some of our readers (feel free to scream if we are, of course). Whether we hammer existing rules or propose new ones, though, shouldn't make too much difference; we seem to be proposing new ideas very gradually, which is a good and welcome thing. > BTW, in rebuttal to whomever couldn't figure out why Gene Genie was a pain > in my ass: > > My DNA is ACTGATATGTACATGATGATACAT > and another player's is GTACGTTACAGTACGTACGATACA. > > What characteristics would our offspring have? Proposal 010 details new Players having random "parents", and describes the process of DNA combination (go through a gene at a time, picking randomly from either parent). Characteristics are then determined from the resulting DNA string. (So you've got a 50% chance of getting your father's eyes.) By having new Players "born" like this, it should mean that they won't be too far behind the rest of us - if, by Week Ten, most Players have human-style eyes and Huge Pointy Teeth, a new person joining us will have a good chance of getting them too. > Now, if said Proposal were accompanied by a program that easily figured > such things out, I'd be more inclined to vote for it. I just don't want > to have to manually calculate data based on some obscure code that is > based in chemical or biological life processes. In the current Proposals, nothing requires you as a Player to manually calculate anything; the DNA-merging for new Players shall be done (implicitly; maybe too implicitly?) by the Speaker, as will the phenotype generation. And the mechanisms for such are all fairly simple, and written clearly in the ruleset. No great obscurity. > (Like, "each player is assigned a chemical formula at random. The number > of Proposals that player may submit is equal to their formula's specific > gravity". It's not that this Proposal wouldn't be a neat concept, just > that I don't want to drag out my high-school chemistry book.) Well, yes, it'd border on the silly if we were expected to refer to some outside reference, or perform some intricate degree-level calculation, and I'd probably start voting against if it got to that point. Having fairly-simple game mechanics *inspired* by neat-concept science is a perfectly good thing, though, if you ask me. > (p.s. caps in this message are for you, kevan) Thankyou. Not that that Tyrannid Proposal was mine, or anything. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 21 06:55:35 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 14:55:51 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 5865 invoked from network); 21 Mar 2000 14:55:46 -0000 Received: from b05.egroups.com (10.1.2.184) by iqg.egroups.com with SMTP; 21 Mar 2000 14:55:46 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.7] by b05.egroups.com with NNFMP; 21 Mar 2000 14:55:46 -0000 Date: Tue, 21 Mar 2000 06:55:42 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8b82he$b2jn@e...> In-Reply-To: <8b7lqc$49a5@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit I've nothing in particular to say, other than that my proposals seem to be undergoing universal lambasting. Perhaps rightly so (in all bar one case, where I seem to have achieved the right sort of style and wording - my first Proposal, in fact, from which point it went downhill); but then, this is my first Nomic, and so I forgive myself. I shall take the comments in, and refine my style. Hopefully, there'll be plenty of time in which to do this. I have ideas for this Week already... rather, I had. I seem to have forgotten already, before writing them down. Bah. Re. Proposal 004 (Megalomaniacs Anonymous): Seems like everyone's a comedian, these days, eh? [grins] [On an aside, what exactly does this eGroups post editor option "Wrap words" do, if not actually wrapping words?] -- TheTwistedOne From Tue Mar 21 07:14:16 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 15:14:32 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 24822 invoked from network); 21 Mar 2000 15:13:32 -0000 Received: from ml.egroups.com (10.1.1.31) by iqg.egroups.com with SMTP; 21 Mar 2000 15:13:32 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.6] by ml.egroups.com with NNFMP; 21 Mar 2000 15:13:32 -0000 Date: Tue, 21 Mar 2000 07:13:30 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8b83ip$2tq5@e...> In-Reply-To: <8b82he$b2jn@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "thetwistedone" [Where's the capitalisation, dammit!] wrote: > [On an aside, what exactly does this eGroups post editor option "Wrap > words" > do, if not actually wrapping words?] Oh, I see. "Wrap words when you actually post the message, but should you want to preview the thing first, well, tough... er... leather." To return to my comments about HTML submissions from eGroups - it seems that if we use the eGroups thing to post, and check "uses HTML", the system decides that I want to receive HTML versions in my mailbox, ignoring that my profile /specifically/ says that I use a text email client (which I've now tried resetting). Apologies if that makes little sense; the eGroups system makes precious little, either. I find myself using it regardless, for both reading and posting, since I tend to be doing so from my workplace. -- TheTwistedOne From Pulp Tue Mar 21 09:25:53 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 17:26:09 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 19402 invoked from network); 21 Mar 2000 17:26:06 -0000 Received: from smtp.wpi.edu (130.215.24.62) by mx3.egroups.com with SMTP; 21 Mar 2000 17:26:06 -0000 Received: from bert.WPI.EDU (root@b... [130.215.24.121]) by smtp.WPI.EDU (8.10.1.Beta0/8.10.1.Beta0) with ESMTP id e2LHQ3o25425 for ; Tue, 21 Mar 2000 12:26:03 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by bert.WPI.EDU (8.10.1.Beta0/8.10.1.Beta0) with ESMTP id e2LHQ2J23726 for ; Tue, 21 Mar 2000 12:26:02 -0500 (EST) Date: Tue, 21 Mar 2000 12:26:02 -0500 (EST) From: Pulp To: genomic@e... In-Reply-To: <8b7lqc$49a5@e...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Time to toss in some reactionary phonemes. Not my actual list of votes, Kevan; I'll get those off to you soon enough. > >Proposal 007 - Statistical Analysis > > Might as well keep this from the start, on the off-chance we can think > of anything interesting to do with it. Not the sort of thing you want > to try and introduce and calculate retroactively in Week 8. Amen, brutha. This is probably the first-mentioned of the proposals to get dogged a bit simply for not seeming immediately useful, which I rather think is a silly thing to bitch about. Assuming something doesn't cause problems for the Speaker (and as the above is Kevan's text, I think it's safe to say it doesn't), what harm can it do? Or, to put it differently, how can it do any more harm than any other proposal? ;) FOR > >Proposal 010 - Gene Genie Very entertaining idea, lots of possibilities. There are so many ways to go with this...mmm. I literally got excited when I read this proposal. FOR > >Proposal 014 - Perls of Wisdom (2) Perl is good, automation is good, passwords are good. FOR > >Proposal 018 - Some Like It Hot FOR (units are nice, environment is depth) > >Proposal 019 - Climatic Conditions Nice idea, but and ice age or a heat wave won't just "Go away" if a couple proposals succeed or fail; we'll only crawl back over the borderline. Unless there is some sudden polarity in the number of good proposals that coincides with an extreme temperature, people will be forced to (a) vote for crappy proposals, or (b) pass up moderately good proposals, just to get back to normal game balance. If this could get reworked a bit with some extra checks, though, I'd be all for it. AGAINST. > >Proposal 024 - Sludge and Pinkness > > "One more attribute, but no real effect to it." says Xylen; surely > such is the way Nomics work, though? Proposing the bare bones of > something and then leaving other people to flesh it out is far > better than saying "Right, here's a complete sub-game for you, off > you go." Ditto. > One strange flaw in the Proposal, though - "Each Player may make > only one sludge transfer per turn." What's a "turn"? Heh. Ditto. I suppose some definitions are in order next week. Random interjection of nostalgia and random thoughts, sort of a Why I Joined This Nomic bit: I grew up on my Nintendo. Video games, back in the day (that is, prior to '90-91 or so and 16-bit consoles) were nice and straightforward. The "rules" were implicit: you did what was possible, and there wasn't really any arguing about it. Coding anything other than a deterministic game was too "out there" and would likely require a bit more silicon real estate and memory footprint than a NES or an Atari 2600 could handle. My next big gaming obsession was "Magic: The Gathering," a "collectable card game" (us insiders call 'em CCGs to save syllables) that spawned the whole gamut of CCGs now clogging the shelves of comic book stores. The game was refreshing at first, because the rules of the game could be somewhat modified during play depending on the contents of each player's deck. Wonderfully addictive, enchanting...expensive. Collecting useful, interesting cards cost too much money, and I lost interest after a while. Another quibble about Magic and it's ilk is that the "initial ruleset" was quite large (the Magic rulebook has grown to about 70 pages at this point, and this is a *card game*) and not entirely lucid in places. The only established avenue to settle rule disputes (other than hedging together some unsatisfying compromise [unsatisfying by definition because any decision will favor one sort of deck over another]) was to check published errata by the company that published the game. Such errata may or may not be available. Recently, I learned about Nomic (a hyperlink off of a page where I learned about, and completely balked at, Mornighton Crescent) and was happier than hell. Here's a game where the rules are dynamic, disputes are (in theory, anyway) handled in house as a matter of course, even as an aspect of the game, and it costs nothing. What a fantastic concept! Sorry about the rant, just happens sometimes. Moving on... > >Proposal 025 - Rule Recombination Wonderful. Self-modifying datasets are very interesting. FOR > >Proposal 029 - Tree of Life > > As Xylen says, anyone can cheerfully draw this without it having to > be a Rule; fair enough, I suppose, but it means our voluntary artist > polling everyone to check who recruited them. And it might be worth > taking the idea further, if we get an interesting tree (or redefine > its structure to make it more interesting). Perhaps we could define a sphere of naivity; that is, the Genomic game can only percieve explicit connections between players, so if someone was referred by, say, the webpage, or a random search on Google (myself), their "root" would be to some metaphysical entity. Maybe start a bit of a forest that way. Or perhaps not, I don't know. :) FOR The next three are mine... > >Proposal 030 - Mysterious Synthesizer Blueprints > > Intriguing. Maybe better after we've got some sort of system for > "locations" and "possessions" and "knowledge", though. Extremely valid point. I sort of wrote this (and the others) up in a flurry of imaginative brainstorming, and I remember thinking at the time that I was being far too implicit about things like possession and knowledge. Silly virgin. Maybe I'll bring this back in a few weeks, edit it up as necessary as well. AGAINST > >Proposal 031 - Cereal Box Tops > > Reasonable enough stuff, and nicely cumulative, rather than the > immediacy of 003. Not sure which I'll go for. Besides, man, my family never bought good cereal when I was a kid; most of the time we didn't buy cereal that came in boxes at all. I ate a lot of granola, and cheap-o store-brand Cheerios and such. Hence my motivation to go with the Box Tops, the mythical, magical Box Tops. FOR > >Proposal 032 - Towers of Law > > Hm, intriguing. It's going to make for a fairly hefty Tower, though. > And the Rule doesn't say whether windows are open or closed when a > new floor is created, which isn't good. Hefty towers might be good, and if not they can certainly be altered by zoning codes and such. ;) As for the windows, valid but I don't think that big of a problem, as any player can in the next week close or open their window at their leisure. I'd recognize the concern more if the tower had any contents or functionality, but as it is I think it's a manageable oversite. FOR My two cents. Pulp Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From Tue Mar 21 12:30:44 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 20:31:00 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 18831 invoked from network); 21 Mar 2000 20:30:58 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 21 Mar 2000 20:30:58 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.123] by mv.egroups.com with NNFMP; 21 Mar 2000 20:30:57 -0000 Date: Tue, 21 Mar 2000 12:30:49 -0800 From: "Oloros" To: genomic@e... Message-ID: <8b8m5p$uv5g@e...> In-Reply-To: User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] knowing when you're at MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > On Tue, 21 Mar 2000, Adam S wrote: > > 1pm GMT? BST? EST? UST? > > paul swanson wrote: > let's not use GMT, it's too confusing...i suggest UTC. > > personnally, I'd rather use Siderial Time. From RavenBlack Tue Mar 21 12:34:14 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 20:34:29 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 22012 invoked from network); 21 Mar 2000 20:34:25 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qh.egroups.com with SMTP; 21 Mar 2000 20:34:25 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12XVM7-0000sS-00 for genomic@e...; Tue, 21 Mar 2000 15:34:24 -0500 Message-Id: <3.0.2.32.20000321153427.03070a0c@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Tue, 21 Mar 2000 15:34:27 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8b7mkm$80rb@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Putting my Foot in It MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >As for the rest of the rules: support anything that you can't see >immediate problems with. What kind of a game are we playing here >anyway? Personally, I'm playing the kind of a game where I'd rather there continue to be a managable and not-nonsensical Ruleset. Voting willy-nilly for any Proposal that doesn't seem explicitly hazardous is a great way to turn the Ruleset into a three-megabyte monster consisting entirely of unrelated nonsense. I advocate a different sort of devil. Proposal 18+19 : Some Like It Hot (Climatic Conditions) I must admit to having only skim-read this pair and assumed it made sense. Looking at people's comments on it, I went and had another look, thinking I must have been mistaken, but no, I was right in the first place, these two make sense. (From people's comments it looked like it was flawed the same way as the Poobah, that a high Temperature would make it tend to get higher. T'isn't so.) There is no obligation for 'odd' Voting to keep the game in a temperate state - it should be self-managing in a similar way to real climatic conditions - excess temperature makes it tend to get cooler, and vice-versa. My only complaint about it would be that the skew is a bit too heavy - 20% to pass could pass a Proposal on only the Player's own Vote, in a quiet week. But that could easily be toned down before it had any effect. There are some other tweaks I'd choose to apply to the Rule too, should it be enacted, but I'll put them in the form of Proposals, if it comes to that. From Tue Mar 21 12:49:03 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 21 Mar 2000 20:49:19 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 853 invoked from network); 21 Mar 2000 20:49:17 -0000 Received: from mw.egroups.com (10.1.2.2) by iqh.egroups.com with SMTP; 21 Mar 2000 20:49:17 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.124] by mw.egroups.com with NNFMP; 21 Mar 2000 20:49:17 -0000 Date: Tue, 21 Mar 2000 12:49:14 -0800 From: "Oloros" To: genomic@e... Message-ID: <8b8n8a$c24k@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: climate and climax MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Proposals 018/019 - climate and effects "effects are rather harsh, and could easily bog the game down (or blow it up)" I'll own up to proposing this one. I wanted to define game states, analogous to the "three minute warning", or "bottom of the eighth", that are similar to each other, but require different styles of play. I think it's rather safe, although I agree it is not entirely predictable. However, it is not as if we cannot legislate global warming out of existance, or even change the boiling point. I am impressed that in the first week we have motions for the construction of a game-world, and an ecology for its inhabitants. I had thought nomic to be a rather cerebral, esoteric undertaking. From Tue Mar 21 20:18:40 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 04:18:56 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 4074 invoked from network); 22 Mar 2000 04:18:55 -0000 Received: from ml.egroups.com (10.1.1.31) by iqg.egroups.com with SMTP; 22 Mar 2000 04:18:55 -0000 X-eGroups-Return: flix_os@h... Received: from [10.1.2.131] by ml.egroups.com with NNFMP; 22 Mar 2000 04:17:57 -0000 Date: Tue, 21 Mar 2000 20:17:49 -0800 From: "Gallivanting Tripper" To: genomic@e... Message-ID: <8b9hhd$10mk@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] The Grand Poobah MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Whoever came up with The Grand Poobah did something I didn't think was possible - a proposal that affects the game before it is enacted. . . ! So what I want to know is - how many of us are going to make a grab for Poobah status on the off chance it passes . . . ? GT From Tue Mar 21 23:41:04 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 07:41:20 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22298 invoked from network); 22 Mar 2000 07:41:19 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 22 Mar 2000 07:41:19 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.5] by mv.egroups.com with NNFMP; 22 Mar 2000 07:41:19 -0000 Date: Tue, 21 Mar 2000 23:41:18 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8b9teu$58kn@e...> In-Reply-To: <8b5jmh$rjng@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: It's offtopic *already* MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "kevan davis" wrote: > I must sort out a decent random-thing generation for Genomic, actually. > Some Nomics favour an email-based dice server Frankly, Kevan - I trust you. For McNomic, I put together about 8 lines of Quickbasic code to do it (Yes - Quickbasic - its a random number generator!) and one of those lines is a comment to myself about what number I last used for the seed. I increment that and use it again. - Mac From Wed Mar 22 00:33:59 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 08:34:15 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 9781 invoked from network); 22 Mar 2000 08:34:08 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqg.egroups.com with SMTP; 22 Mar 2000 08:34:08 -0000 X-eGroups-Return: dmckenna@x... Received: from [10.1.2.131] by mv.egroups.com with NNFMP; 22 Mar 2000 08:34:07 -0000 Date: Wed, 22 Mar 2000 00:34:04 -0800 From: "David S. McKenna" To: genomic@e... Message-ID: <8ba0hr$14em@e...> In-Reply-To: <8b7mkm$80rb@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Putting my Foot in It MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit It seems unlikely to me that life is going to allow me a full ballot commentary for the current ballot, but something in this post spoke to me for comment and/or discussion.... Suppose I craft a proposal such that the rule reads: "Should a player ever attain a total of 18 yada-yada's, and that player does not already have at least 4 thingamabobs, that player will be awarded a tootsie roll" I never said "If". I never said "unless". I never said "then". But the implications are clear. Perhaps the mutant rule proposal fails to mention this on purpose. This Mutant Rule proposal can be rendered SOMEWHAT harmless by careful wording of future proposals. I'm only a little concerned about its retroactivity (Kevan will attest to my seeming obsession on this point) in that these proposals on which we vote this week may become mining fields for Mutant Rule, a concept of which the proposers were unaware when they submitted their proposals. (The initial Ruleset didn't see it coming either.) I think it likely I will vote for this one anyway, tho - The randomly created rule will at least be amusing, and since my proposals always tend to be "lets tidy this up a bit" rather than genuinely creative, (and I have offered nothing to vote upon this week) the retroactivity of it doesn't appear to affect me. And in comparison to these proposals, McNomic is a child's game. Please forgive me for mentioning it. From Wed Mar 22 05:42:11 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 13:42:27 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 13084 invoked from network); 22 Mar 2000 13:42:23 -0000 Received: from fg.egroups.com (10.1.2.134) by iqh.egroups.com with SMTP; 22 Mar 2000 13:42:23 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.128] by fg.egroups.com with NNFMP; 22 Mar 2000 13:42:22 -0000 Date: Wed, 22 Mar 2000 05:42:15 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8baijn$pn07@e...> In-Reply-To: <8b8m5p$uv5g@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: knowing when you're at MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "oloros" wrote: original article:http://www.egroups.com/group/genomic/?start=91 > > On Tue, 21 Mar 2000, Adam S wrote: > > > 1pm GMT? BST? EST? UST? > > > > paul swanson wrote: > > let's not use GMT, it's too confusing...i suggest UTC. > > > > > personnally, I'd rather use Siderial Time. > Bah. Nonsense. http://www.timecube.com provides the most sane time system, albeit in a thoroughly /in/sane manner. From Wed Mar 22 12:13:40 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 20:13:56 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 506 invoked from network); 22 Mar 2000 20:13:54 -0000 Received: from c9.egroups.com (10.1.2.66) by iqh.egroups.com with SMTP; 22 Mar 2000 20:13:54 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.131] by c9.egroups.com with NNFMP; 22 Mar 2000 20:13:53 -0000 Date: Wed, 22 Mar 2000 12:13:44 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bb9ho$g2k@e...> In-Reply-To: <8baijn$pn07@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: knowing when you're at MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Bah. Nonsense. http://www.timecube.com provides the most sane time > system, albeit in a thoroughly /in/sane manner. Given that RavenBlack, who has known me for almost five years, didn't understand that I wasn't being entirely serious, I shall point out that I'm not being serious. I'm not being serious. On another note, I'm happy to use GMT for Genomic-time. In fact, I assumed that we were using GMT, because Kevan is in the UK, and the initial Ruleset states that the Interregnum starts on Monday, at 1pm (GMT). Such should be, I think, implied until the Ruleset is modified to say otherwise. Also remember that thanks to the now (ever?) useless Daylight Saving Time, 1pm is really 2pm next monday. It's not like I can cope with getting up at 8am now - I'm /really/ going to have trouble when 8am is 7am... Dunramblin', TheTwistedOne From Wed Mar 22 13:45:32 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 21:45:46 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 18012 invoked from network); 22 Mar 2000 21:45:41 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 22 Mar 2000 21:45:41 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.120] by mv.egroups.com with NNFMP; 22 Mar 2000 21:45:40 -0000 Date: Wed, 22 Mar 2000 13:45:32 -0800 From: "Oloros" To: genomic@e... Message-ID: <8bbets$khee@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] point of order MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Kevan, may I ask that the Proposals you receive this week be numbered consecutively from 37+ (36 this week)? so that we may refer to the text of past Proposals whether or not they were voted into the Ruleset. I understand that this is a topic that should have been addressed this week with a Proposal, and that I am asking for a Gentlemen's Agreement before we have any way to invoke one. -Oloros From Xylen Wed Mar 22 14:35:03 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 22 Mar 2000 22:35:19 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 24618 invoked from network); 22 Mar 2000 22:35:15 -0000 Received: from eagle.acns.colostate.edu (129.82.100.90) by mx3.egroups.com with SMTP; 22 Mar 2000 22:35:15 -0000 Received: from yuma.ACNS.Colostate.EDU (yuma.ACNS.ColoState.EDU [129.82.100.64]) by eagle.ACNS.ColoState.EDU (AIX4.3/UCB 8.8.8/8.8.8) with ESMTP id PAA42524 for ; Wed, 22 Mar 2000 15:35:15 -0700 Received: from holly.colostate.edu (res099037.HALLS.ColoState.EDU [129.82.99.37]) by yuma.ACNS.Colostate.EDU (AIX4.3/UCB 8.8.8/8.8.8) with ESMTP id PAA95308 for ; Wed, 22 Mar 2000 15:35:15 -0700 Message-ID: <38D94AA0.B6187DD9@h...> Date: Wed, 22 Mar 2000 15:35:12 -0700 From: Xylen X-Mailer: Mozilla 4.7 [en] (Win95; U) X-Accept-Language: en,pdf To: genomic@e... References: <8bbets$khee@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: point of order MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Oloros wrote: > > Kevan, may I ask that the Proposals you receive this week be numbered > consecutively from 37+ (36 this week)? so that we may refer to the text > of past Proposals whether or not they were voted into the Ruleset. > > I understand that this is a topic that should have been addressed this > week with a Proposal, and that I am asking for a Gentlemen's Agreement > before we have any way to invoke one. Actually it won't be that bad if they aren't number 37+. I am tracking the props as 1.1 to 1.36 and next week will be 2.1 to 2.?. I suppose you could even go so far as (year).(week).(prop #) instead of (week).(prop #). Hmm, maybe I will write this up as one of my props for this week. Xylen -- __^__ __^__ ( ___ )------------------------------( ___ ) | / | This message has been brought | \ | | / | to you by the language C and | \ | |___| the number F |___| (_____)------------------------------(_____) From RavenBlack Wed Mar 22 16:09:39 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 23 Mar 2000 00:09:55 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 16093 invoked from network); 23 Mar 2000 00:09:53 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by mx3.egroups.com with SMTP; 23 Mar 2000 00:09:53 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12XvCB-0004Fj-00 for genomic@e...; Wed, 22 Mar 2000 19:09:51 -0500 Message-Id: <3.0.2.32.20000322190840.007645c8@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Wed, 22 Mar 2000 19:08:40 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8bb9ho$g2k@e...> References: <8baijn$pn07@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: knowing when you're at MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit [timecube] >Given that RavenBlack, who has known me for almost five years, didn't >understand that I wasn't being entirely serious, I shall point out >that I'm not being serious. >I'm not being serious. I grumble. My comments to him about the timecube thing were about the email that wasn't sent to the mailing list. I knew the one to the mailing list was being silly. Tsch. --RavenBlack From Thu Mar 23 12:08:47 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 23 Mar 2000 20:09:03 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 572 invoked from network); 23 Mar 2000 20:09:03 -0000 Received: from b05.egroups.com (10.1.2.184) by iqh.egroups.com with SMTP; 23 Mar 2000 20:09:03 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.5] by b05.egroups.com with NNFMP; 23 Mar 2000 20:09:02 -0000 Date: Thu, 23 Mar 2000 12:09:00 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bdtks$mp08@e...> In-Reply-To: <8bbets$khee@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: point of order MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Kevan, may I ask that the Proposals you receive this week be numbered > consecutively from 37+ (36 this week)? so that we may refer to the text > of past Proposals whether or not they were voted into the Ruleset. > > I understand that this is a topic that should have been addressed this > week with a Proposal, and that I am asking for a Gentlemen's Agreement > before we have any way to invoke one. I was planning to do this anyway; since the Ruleset doesn't specify either way on the numbering issue (or, indeed, that Proposals should be numbered by the Speaker at all), it's a matter of personal whim. There's no real need to waste a Proposal on declaring it explicitly, unless you're worried that I might wake up one morning with a mad desire to number it all in randomly-ordered ASCII-art cuneiform. A general note about Monday's Interregnum, by the way; the place I'm working at the moment is cheerfully selling off everything in its offices as a prelude to closing down - the network server went yesterday, and my own PC was dragged away from me this afternoon. As a result, I lack any sort of daytime Internet access for the time being (hopefully I'll be able to get myself a job with the Web design place down the corridor, fairly quickly), and won't be able to wrap up Monday's Interregnum until about half-six in the evening. Probably. Tsk. Kevan -- kevan@s... http://www.stormloader.com/kevan From Fri Mar 24 01:56:18 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 09:56:35 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 17241 invoked from network); 24 Mar 2000 09:56:34 -0000 Received: from cj.egroups.com (10.1.2.82) by iqh.egroups.com with SMTP; 24 Mar 2000 09:56:34 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.120] by cj.egroups.com with NNFMP; 24 Mar 2000 09:56:33 -0000 Date: Fri, 24 Mar 2000 01:56:33 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bfe4h$qfuu@e...> In-Reply-To: <38D69DB0.4F5D41CE@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > > 001 FOR Your Vote can make a difference (sure why the hell not) > I personally don't see what effect the new wording would have. I'm > inclined to leave things as they were, unless there is a definite reason > for a change. AGAINST You couldn't be more wrong. There is a [i]very[/i] definite reason for the change. --TheTwistedOne From Fri Mar 24 03:00:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 11:00:22 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 20448 invoked from network); 24 Mar 2000 11:00:20 -0000 Received: from oe30.law7.hotmail.com (HELO hotmail.com) (216.33.236.25) by qg.egroups.com with SMTP; 24 Mar 2000 11:00:20 -0000 Received: (qmail 3463 invoked by uid 65534); 24 Mar 2000 11:00:17 -0000 Message-ID: <20000324110017.3462.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bfe4h$qfuu@e...> Date: Fri, 24 Mar 2000 10:59:01 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0012_01BF957F.F6745EB0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0012_01BF957F.F6745EB0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > > 001 FOR Your Vote can make a difference (sure why the hell not) > I personally don't see what effect the new wording would have. I'm > inclined to leave things as they were, unless there is a definite reason > for a change. AGAINST You couldn't be more wrong. There is a [i]very[/i] definite reason for the change. Are you going to share it with us? Adam ------=_NextPart_000_0012_01BF957F.F6745EB0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
> > 001 FOR Your Vote can make a difference (su=
re why the hell
not)
> I personally don't see what effect the new wording would have. I'm
> inclined to leave things as they were, unless there is a definite
reason
> for a change. AGAINST

You couldn't be more wrong. There is a [i]very[/i] definite reason for
the change.


 
Are you going to share it with us?
&n=
bsp;
Adam
------=_NextPart_000_0012_01BF957F.F6745EB0-- From Fri Mar 24 03:10:54 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 11:11:11 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22931 invoked from network); 24 Mar 2000 11:11:05 -0000 Received: from b05.egroups.com (10.1.2.184) by iqh.egroups.com with SMTP; 24 Mar 2000 11:11:05 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.5] by b05.egroups.com with NNFMP; 24 Mar 2000 11:11:04 -0000 Date: Fri, 24 Mar 2000 03:10:55 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bfifv$7skg@e...> In-Reply-To: <20000324110017.3462.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Are you going to share it with us? Yes. After the Interregnum. --TheTwistedOne From Fri Mar 24 03:14:20 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 11:14:36 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 27540 invoked from network); 24 Mar 2000 11:14:34 -0000 Received: from oe51.law7.hotmail.com (HELO hotmail.com) (216.33.236.87) by qg.egroups.com with SMTP; 24 Mar 2000 11:14:34 -0000 Received: (qmail 97356 invoked by uid 65534); 24 Mar 2000 11:14:34 -0000 Message-ID: <20000324111434.97355.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bfifv$7skg@e...> Date: Fri, 24 Mar 2000 11:13:19 -0000 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_000C_01BF9581.F5D74970" Content-Transfer-Encoding: 7bit ------=_NextPart_000_000C_01BF9581.F5D74970 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Are you going to share it with us? Yes. After the Interregnum. Well, that's convinced me to vote! *grins* (I'm at work, and too tired to think, I've got to sort out my next weeks = proposals yet) Hmm, just an aside as a proposal thought - would it be better to have the= week plit into 2 parts, so that next weeks proposals are poasted after thi= s weeks are voted upon - otherwise I might want to pose a poposal to alter = a rule that hasn't gone through, but don't want to waste a proposal that b= egins "If proposal XYZ is passed...", but equally I don't want to take the = existing not-quite-yet-a-rule and reqrite it to be my amendment. Ok, I'm rambling, if any of it made sense, then feel free to comment! :) ------=_NextPart_000_000C_01BF9581.F5D74970 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
 
> Are you going to share it with us?
Yes. After the = Interregnum.

Well, that's convinced me to vo= te! = *grins*
 
(I'm at work, and too tired to think, I've got to sor= t out = my next weeks proposals yet)
 
Hmm, just an aside as a proposal thought - would it b= e = better to have the week plit into 2 parts, so that next weeks proposals a= re = poasted after this weeks are voted upon - otherwise I might want to pose = a = poposal to alter a rule that hasn't gone through,  but don't want to= = waste a proposal that begins "If proposal XYZ is passed...", but equally = I = don't want to take the existing not-quite-yet-a-rule and reqrite it to be= my = amendment.
 
Ok, I'm rambling, if any of it made sense, then feel = free to = comment! :)
------=_NextPart_000_000C_01BF9581.F5D74970-- From Fri Mar 24 03:31:06 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 11:31:23 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 6245 invoked from network); 24 Mar 2000 11:31:21 -0000 Received: from ml.egroups.com (10.1.1.31) by iqg.egroups.com with SMTP; 24 Mar 2000 11:31:21 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.15] by ml.egroups.com with NNFMP; 24 Mar 2000 11:31:21 -0000 Date: Fri, 24 Mar 2000 03:31:21 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bfjm9$ghhv@e...> In-Reply-To: <20000324111434.97355.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Hmm, just an aside as a proposal thought - would it be better to have the week plit into 2 parts, so that next weeks proposals are poasted after this weeks are voted upon - otherwise I might want to pose a poposal to alter a rule that hasn't gone through, but don't want to waste a proposal that begins "If proposal XYZ is passed...", but equally I don't want to take the existing not-quite-yet-a-rule and reqrite it to be my amendment. > I have a similar concern (er, I think [grins]), but I'm just going to let a Proposal gestate subconsciously for a while. Unless, that is, someone should Propose a suitable solution before I'm done. --TheTwistedOne From Graeme Jefferis Fri Mar 24 05:23:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 13:23:22 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 15669 invoked from network); 24 Mar 2000 13:23:20 -0000 Received: from chopin.dmu.ac.uk (HELO dmu.ac.uk) (146.227.1.74) by mx3.egroups.com with SMTP; 24 Mar 2000 13:23:20 -0000 Received: from garozzo.cse.dmu.ac.uk (root@g... [146.227.102.42]) by dmu.ac.uk (8.10.0.Beta12/8.10.0.Beta12) with ESMTP id e2ODLmD08113 for ; Fri, 24 Mar 2000 13:21:48 GMT Received: from arapaho.cs.cse.dmu.ac.uk (se98gj@a... [146.227.102.7]) by garozzo.cse.dmu.ac.uk (8.9.3/8.9.3/g3.1b) with ESMTP id NAA24766 for ; Fri, 24 Mar 2000 13:23:18 GMT From: Graeme Jefferis Received: (from se98gj@l...) by arapaho.cs.cse.dmu.ac.uk (8.9.3/8.9.3/c1.8) id NAA21668 for genomic@egroups.com; Fri, 24 Mar 2000 13:23:12 GMT Date: Fri, 24 Mar 2000 13:23:12 GMT Message-Id: <200003241323.NAA21668@a...> To: genomic@egroups.com Content-MD5: xsLcjawJzl+7s33M3DnxMw== Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit >> You couldn't be more wrong. There is a [i]very[/i] definite >> reason for the change. > > Are you going to share it with us? I've spotted it, and I advise everyone to vote FOR this proposal. It's a worthwhile fix of a nasty loophole; if it were revealed, then some scoundrel might choose to abuse it. Excuse my inaction this week: I've been in Switzerland on a job interview. -Grimace. From Fri Mar 24 14:09:02 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 22:09:20 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22729 invoked from network); 24 Mar 2000 22:09:19 -0000 Received: from mw.egroups.com (10.1.2.2) by iqh.egroups.com with SMTP; 24 Mar 2000 22:09:19 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.121] by mw.egroups.com with NNFMP; 24 Mar 2000 22:09:18 -0000 Date: Fri, 24 Mar 2000 14:09:10 -0800 From: "Oloros" To: genomic@e... Message-ID: <8bgp26$oh3g@e...> In-Reply-To: <8bfe4h$qfuu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals [P001] MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "thetwistedone" wrote: > > > 001 FOR Your Vote can make a difference (sure why the hell > not) > > You couldn't be more wrong. There is a [i]very[/i] definite reason for > the change. > > --TheTwistedOne > I concur with TheTwistedOne, and Graeme. This could be very interesting, particularly with regards to GT's notes on the effects of the Grand Poohbah Proposal before it passes . . . -Oloros From Fri Mar 24 14:49:06 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 24 Mar 2000 22:49:23 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8499 invoked from network); 24 Mar 2000 22:46:56 -0000 Received: from ci.egroups.com (10.1.2.81) by iqg.egroups.com with SMTP; 24 Mar 2000 22:46:56 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.123] by ci.egroups.com with NNFMP; 24 Mar 2000 22:46:56 -0000 Date: Fri, 24 Mar 2000 14:46:51 -0800 From: "Oloros" To: genomic@e... Message-ID: <8bgr8r$abt1@e...> In-Reply-To: <38D94AA0.B6187DD9@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: point of order: proposal numbering MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Oloros wrote: > > > > Kevan, may I ask that the Proposals you receive this week be numbered > > consecutively from 37+ (36 this week)? so that we may refer to the text > > of past Proposals whether or not they were voted into the Ruleset. > > > > I understand that this is a topic that should have been addressed this > > week with a Proposal, and that I am asking for a Gentlemen's Agreement > > before we have any way to invoke one. > xylen wrote: > Actually it won't be that bad if they aren't number 37+. I am tracking > the props as 1.1 to 1.36 and next week will be 2.1 to 2.?. I suppose you > could even go so far as (year).(week).(prop #) instead of (week).(prop > #). Hmm, maybe I will write this up as one of my props for this week. > I fished, and did not write the proposal that would have required a numbering scheme. Shall we move this topic into a general discussion of Proposal Numbering Schema? If we take the western calander as an example, we refer to dates by day/month, but occaisonally by day-of-year as well. Let us propose the same for Proposals (era).(week).(prop#) note that I am even now replacing Year with Era, from the idea that we not confuse game number with chronological time. -Oloros From Sat Mar 25 08:42:47 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 25 Mar 2000 16:43:04 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 4239 invoked from network); 25 Mar 2000 16:43:02 -0000 Received: from mo.egroups.com (10.1.1.34) by iqh.egroups.com with SMTP; 25 Mar 2000 16:43:02 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.121] by mo.egroups.com with NNFMP; 25 Mar 2000 16:43:02 -0000 Date: Sat, 25 Mar 2000 08:43:02 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8biqam$pd4v@e...> In-Reply-To: <8bgr8r$abt1@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: point of order: proposal numbering MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Xylen said:- > Actually it won't be that bad if they aren't number 37+. I am tracking > the props as 1.1 to 1.36 and next week will be 2.1 to 2.?. I suppose you > could even go so far as (year).(week).(prop #) instead of (week).(prop > #). Hmm, maybe I will write this up as one of my props for this week. Well, if anyone feels that simple integer numbering isn't sufficient, it'll take either a Proposal or some reasonable persuasion to adjust my thoughts on the matter. I'm fairly indifferent as to whether we use "integer" or "week.integer", really - the former seems easier and more casual, as well as giving a pleasing count of the Proposals that have been made to date. The latter maybe has a *slight* edge when wanting to refer to very old Proposals, but saying "Proposal 23, back in Week Three" instead is virtually the same, and it's fairly rare that old Proposals will be referenced. Oloros said:- > note that I am even now > replacing Year with Era, from the idea that we not confuse game number > with chronological time. Mornington Nomic got a bit confused on that issue, and ended up rolling the year forward every time we hit an anniversary of Nomic-foundation. It's not hugely important, really. Kevan -- kevan@s... http://www.stormloader.com/kevan From Sun Mar 26 07:38:43 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 26 Mar 2000 15:39:01 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 7122 invoked from network); 26 Mar 2000 15:38:54 -0000 Received: from mq.egroups.com (10.1.1.36) by iqg.egroups.com with SMTP; 26 Mar 2000 15:38:54 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.127] by mq.egroups.com with NNFMP; 26 Mar 2000 15:38:54 -0000 Date: Sun, 26 Mar 2000 07:38:48 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8blau8$qg89@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] The End is Nigh MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Just a reminder that Week Two will be ending at 1pm (GMT) tomorrow; if you've not voted yet (Pulp, Raven and TopHeavy have yet to vote, according to my records), or have any more Proposals to make, be sure to get them in by then. And further to previous Interregnum blather, I'm segueing into a new job tomorrow - I may or may not have the time to get Votes and Proposals posted, and (more terrifyingly) the Ruleset updated in light of voting results. The Interregnum could end anywhere between lunchtime Monday and lunchtime Tuesday, really. Bear with me on that one. Your Speaker, Kevan -- kevan@s... http://www.stormloader.com/kevan From Sun Mar 26 07:44:21 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 26 Mar 2000 15:44:39 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 10421 invoked from network); 26 Mar 2000 15:44:38 -0000 Received: from fg.egroups.com (10.1.2.134) by iqg.egroups.com with SMTP; 26 Mar 2000 15:44:38 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.130] by fg.egroups.com with NNFMP; 26 Mar 2000 15:44:38 -0000 Date: Sun, 26 Mar 2000 07:44:33 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8blb91$g3cs@e...> In-Reply-To: <20000320231751.88496.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: My two cents! MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > And that's pretty much all. BTW, Kevan, these are my votes, for the record, > on the grounds that rule 6 says "should". ;-) And I've just had to wade tediously through a load of old mailing list postings looking for them, as I slowly prepare the Interregnum stuff. Expect a grumpy Proposal on this issue, tomorrow. Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 27 04:26:18 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 12:26:36 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 5695 invoked from network); 27 Mar 2000 12:26:35 -0000 Received: from b05.egroups.com (10.1.2.184) by iqg.egroups.com with SMTP; 27 Mar 2000 12:26:35 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.121] by b05.egroups.com with NNFMP; 27 Mar 2000 12:26:34 -0000 Date: Mon, 27 Mar 2000 04:26:28 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnk1k$pira@e...> In-Reply-To: <200003241323.NAA21668@a...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > It's a worthwhile fix of a nasty loophole; if it were revealed, > then some scoundrel might choose to abuse it. A nasty loophole indeed. Since we've hit the Interregnum and Voting has closed, I shall spill the beans. As it stands, Rule 006 (Votes) simply says that the Player has a pool of Votes, the size matching the number of Proposals that Week. So, for Week Two, we each had 36 Votes. "Yes," you might say, "that's sensible." To which I would retort, "Ah, but that's /all/ the Rule says. It says nothing about how you actually /apply/ those Votes." Y'see, I cast 11 Votes AGAINST Proposal 001 (which I Proposed), and the other 25 FOR Proposal 004 (Megalomaniacs Anonymous). Which, by the current Ruleset, is completely legal. Does Proposal 001 make sense now? --TheTwistedOne From Mon Mar 27 04:42:49 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 12:43:07 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 18040 invoked from network); 27 Mar 2000 12:43:05 -0000 Received: from oe29.law7.hotmail.com (HELO hotmail.com) (216.33.236.249) by qg.egroups.com with SMTP; 27 Mar 2000 12:43:05 -0000 Received: (qmail 32246 invoked by uid 65534); 27 Mar 2000 12:43:04 -0000 Message-ID: <20000327124304.32245.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnk1k$pira@e...> Date: Mon, 27 Mar 2000 13:39:07 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_001D_01BF97F1.D36FB850" Content-Transfer-Encoding: 7bit ------=_NextPart_000_001D_01BF97F1.D36FB850 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Hmmm. Let's get picky now. = "During a given Week, each Player may cast one Vote for every Proposal that= was distributed by the Speaker at the start of that Week. This Vote may be= either "FOR", "AGAINST" or "PASS"." Hmmm. You may "cast one Vote for every Proposal" It doesn't actually mentio= n that you can cast Votes against proposals at all. Therefore I move that y= ou can't cast Votes, in the sense that you cannot Vote with regards to a Pr= oposal, at ALL. Am I wrong? ----- Original Message ----- = From: TheTwistedOne = To: genomic@e... = Sent: Monday, March 27, 2000 1:26 PM Subject: [genomic] Re: Week Two Proposals > It's a worthwhile fix of a nasty loophole; if it were revealed, > then some scoundrel might choose to abuse it. A nasty loophole indeed. Since we've hit the Interregnum and Voting has closed, I shall spill the beans. As it stands, Rule 006 (Votes) simply says that the Player has a pool of Votes, the size matching the number of Proposals that Week. So, for Week Two, we each had 36 Votes. "Yes," you might say, "that's sensible." To which I would retort, "Ah, but that's /all/ the Rule says. It says nothing about how you actually /apply/ those Votes." Y'see, I cast 11 Votes AGAINST Proposal 001 (which I Proposed), and the other 25 FOR Proposal 004 (Megalomaniacs Anonymous). Which, by the current Ruleset, is completely legal. Does Proposal 001 make sense now? --TheTwistedOne ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_001D_01BF97F1.D36FB850 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Hmmm. Let's get picky now.
 
"During a given Week, each Player= may cast = one Vote for every Proposal that was distributed by the Speaker at the star= t of = that Week. This Vote may be either "FOR", "AGAINST" or "PASS"."
 
Hmmm. You may "cast one Vote for every Proposal" It doe= sn't = actually mention that you can cast Votes against proposals at all. Therefor= e I = move that you can't cast Votes, in the sense that you cannot Vote with rega= rds = to a Proposal, at ALL.
 
Am I wrong?
----- Original Message -----
Fro= m: = TheTwistedOne
Sent: Monday, March 27, 2000 1:26 = PM
Subject: [genomic] Re: Week Two = Proposals

> It's a worthwhile fix of a nasty loophole; if it were= = revealed,
> then some scoundrel might choose to abuse it.
A nast= y = loophole indeed.

Since we've hit the Interregnum and Voting has cl= osed, = I shall spill
the beans. As it stands, Rule 006 (Votes) simply says th= at = the Player
has a pool of Votes, the size matching the number of Propos= als = that
Week.

So, for Week Two, we each had 36 Votes. "Yes," you m= ight = say, "that's
sensible."

To which I would retort, "Ah, but that'= s = /all/ the Rule says. It says
nothing about how you actually /apply/ th= ose = Votes."

Y'see, I cast 11 Votes AGAINST Proposal 001 (which I Propo= sed), = and the
other 25 FOR Proposal 004 (Megalomaniacs Anonymous). Which, by= = the
current Ruleset, is completely legal.

Does Proposal 001 mak= e = sense now?

--TheTwistedOne

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_001D_01BF97F1.D36FB850-- From Mon Mar 27 04:46:20 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 12:46:38 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 20919 invoked from network); 27 Mar 2000 12:46:37 -0000 Received: from ci.egroups.com (10.1.2.81) by iqg.egroups.com with SMTP; 27 Mar 2000 12:46:37 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.131] by ci.egroups.com with NNFMP; 27 Mar 2000 12:46:37 -0000 Date: Mon, 27 Mar 2000 04:46:35 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bnl7b$gngf@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week Two Voting Results MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit ----------------------------------------------------------------------- ------ VOTING RESULTS FOR WEEK TWO ----------------------------------------------------------------------- ------ Num Proposal Name Proposer F P A Result +-----+---------------------------------+------------+---+---+---+----- ---+ | 001 | Your Vote Can Make a Difference | TwistedOne | 9 | 0 |14 | FAIL | | 002 | Cash in your Chips | TwistedOne | 0 | 0 |12 | FAIL | | 003 | Proposing is its own reward | Tyrethali | 4 | 1 | 7 | FAIL | | 004 | Megalomaniacs Anonymous | TwistedOne |26 | 0 |11 | PASS | | 005 | Democratica Mortis | TwistedOne | 0 | 0 |12 | FAIL | | 006 | Paradox! | TwistedOne | 5 | 0 | 7 | FAIL | | 007 | Statistical Analysis | RavenBlack | 9 | 0 | 3 | PASS | | 008 | Siamese Twins | RavenBlack | 9 | 0 | 2 | PASS | | 009 | Legalise Creationism | Grimace | 8 | 0 | 4 | PASS | | 010 | Gene Genie | Kevan |10 | 1 | 1 | PASS | | 011 | Data Protection Act | Kevan |10 | 1 | 1 | PASS | | 012 | The Tyrranids Are Coming! | RavenBlack | 3 | 2 | 7 | FAIL | | 013 | Perls of Wisdom | RavenBlack | 4 | 2 | 6 | FAIL | | 014 | Perls of Wisdom (2) | RavenBlack | 9 | 1 | 2 | PASS | * | 015 | Begin the Beguinne | Oloros | 5 | 0 | 7 | FAIL | | 016 | Tom Waits for No One | Oloros |11 | 0 | 1 | PASS | | 017 | The Grand Poohbah | Oloros | 1 | 1 |10 | FAIL | | 018 | Some Like It Hot | Oloros |10 | 1 | 1 | PASS | ** | 019 | Climatic Conditions | Oloros | 4 | 1 | 7 | FAIL | | 020 | No Comment? | Kevan |10 | 1 | 1 | PASS | | 021 | Survival of the Fittest | Kevan | 5 | 2 | 5 | FAIL | | 022 | Does somebody need a hug? | Xylen | 4 | 3 | 5 | FAIL | | 023 | Oopps | Xylen | 8 | 2 | 2 | PASS | | 024 | Sludge and Pinkness | Xylen | 6 | 2 | 4 | PASS | *** | 025 | Rule Recombination | G. Tripper | 6 | 2 | 4 | PASS | | 026 | Mutate or Die | G. Tripper | 1 | 0 |11 | FAIL | | 027 | Out of the Pond Scum | G. Tripper | 6 | 0 | 6 | FAIL | | 028 | God does not Play at Dice | G. Tripper | 3 | 1 | 8 | FAIL | | 029 | Tree of Life | Kevan | 7 | 1 | 4 | PASS | + | 030 | Mysterious Synthesizer Bluep... | Pulp | 3 | 0 | 9 | FAIL | | 031 | Cereal Box Tops | Pulp | 7 | 1 | 4 | PASS | | 032 | Towers of Law | Pulp | 6 | 1 | 5 | PASS | | 033 | Rule 4 Addendum: Up-To-Two-w... | microstn'd | 1 | 2 | 8 | FAIL | | 034 | Rule 4 Change: Exactly One-w... | microstn'd | 4 | 2 | 5 | FAIL | | 035 | Rule 6 Addendum: Default PAS... | microstn'd | 4 | 0 | 7 | FAIL | | 036 | Rule 6 Change: Anonymonity a... | microstn'd | 7 | 0 | 4 | PASS | ++ +-----+---------------------------------+------------+---+---+---+----- ---+ ----------------------------------------------------------------------- ------ INDIVIDUAL VOTES ----------------------------------------------------------------------- ------ Num DJA G.T Grm Kev Mac Max mic Olo Pul Rav Top TTO Tyr Xyl +-----+---------------------------------------------------------+ | 001 | AGA FOR FOR FOR FOR AGA FOR FOR FOR FOR - 11A FOR AGA | +++ | 002 | AGA AGA AGA AGA AGA AGA AGA AGA AGA AGA - - AGA AGA | | 003 | AGA FOR AGA PAS AGA AGA AGA FOR AGA FOR - - FOR AGA | | 004 | AGA AGA AGA FOR AGA AGA AGA AGA AGA AGA - 25F AGA AGA | +++ | 005 | AGA AGA AGA AGA AGA AGA AGA AGA AGA AGA - - AGA AGA | | 006 | AGA FOR FOR FOR AGA AGA AGA AGA AGA FOR - - FOR AGA | | 007 | FOR FOR AGA FOR FOR FOR FOR FOR FOR FOR - - AGA AGA | | 008 | FOR FOR FOR FOR AGA AGA FOR FOR AGA FOR - - FOR FOR | | 009 | FOR FOR FOR FOR AGA AGA AGA AGA FOR FOR - - FOR FOR | | 010 | FOR FOR FOR FOR FOR FOR PAS FOR FOR FOR - - AGA FOR | | 011 | PAS FOR FOR FOR FOR AGA FOR FOR FOR FOR - - FOR FOR | | 012 | PAS FOR AGA PAS AGA AGA AGA FOR AGA FOR - - AGA AGA | | 013 | PAS FOR AGA PAS FOR AGA FOR AGA AGA FOR - - AGA AGA | | 014 | PAS FOR FOR FOR FOR AGA FOR AGA FOR FOR - - FOR FOR | | 015 | AGA FOR AGA AGA FOR AGA FOR FOR AGA FOR - - AGA AGA | | 016 | FOR FOR FOR FOR FOR FOR FOR FOR FOR FOR - - AGA FOR | | 017 | PAS FOR AGA AGA AGA AGA AGA AGA AGA AGA - - AGA AGA | | 018 | PAS FOR FOR FOR FOR FOR AGA FOR FOR FOR - - FOR FOR | | 019 | PAS FOR AGA AGA AGA AGA AGA FOR AGA FOR - - AGA FOR | | 020 | PAS FOR FOR FOR FOR AGA FOR FOR FOR FOR - - FOR FOR | | 021 | PAS FOR AGA FOR AGA AGA AGA FOR FOR PAS - - FOR AGA | | 022 | PAS FOR FOR AGA AGA FOR PAS AGA FOR PAS - - AGA AGA | | 023 | PAS FOR FOR FOR FOR FOR FOR AGA AGA PAS - - FOR FOR | | 024 | PAS AGA FOR FOR AGA FOR AGA FOR FOR PAS - - AGA FOR | | 025 | PAS FOR FOR FOR FOR AGA AGA FOR FOR PAS - - AGA AGA | | 026 | AGA FOR AGA AGA AGA AGA AGA AGA AGA AGA - - AGA AGA | | 027 | FOR FOR FOR AGA FOR AGA FOR AGA AGA AGA - - AGA FOR | | 028 | FOR FOR AGA AGA AGA AGA PAS AGA AGA AGA - - FOR AGA | | 029 | FOR FOR FOR FOR AGA FOR AGA FOR AGA PAS - - FOR AGA | | 030 | FOR FOR FOR AGA AGA AGA AGA AGA AGA AGA - - AGA AGA | | 031 | FOR FOR FOR FOR FOR AGA AGA FOR FOR PAS - - AGA AGA | | 032 | AGA AGA FOR AGA AGA FOR PAS AGA FOR FOR - - FOR FOR | | 033 | PAS FOR AGA AGA AGA - PAS AGA AGA AGA - - AGA AGA | | 034 | PAS FOR AGA AGA AGA - FOR AGA AGA PAS - - FOR FOR | | 035 | FOR FOR FOR AGA AGA - FOR AGA AGA AGA - - AGA AGA | | 036 | FOR FOR FOR AGA AGA - FOR AGA FOR FOR - - AGA FOR | +-----+---------------------------------------------------------+ ----------------------------------------------------------------------- ------ PLAYER/GAME STATISTICS ----------------------------------------------------------------------- ------ (There were thirty-six Proposals during Week One, and seventeen of them passed. A healthy four-hundred and sixty-four Votes were cast.) Slu Box Strt Prps Prps Vots Senio Player DNA String dge Tops Week Made Acpt Cast -rity +------------+-------------------------+----+----+----+----+----+----+- ----+ | DJ Arcas | TACAGTAGGCATTGAGGCCGCAT | 20 | 0 | 1 | 3 | 0 | 36 | 1 | | G. Tripper | ATCATCCGCCTGAGGGCATATGC | 20 | 0 | 1 | 9 | 1 | 36 | 1 | | Grimace | CAGTGAACATGCGATAGCAACTG | 20 | 0 | 1 | 3 | 1 | 36 | 1 | | Kevan | AAGTCGCGTCCTTCTCCGATCAG | 20 | 0 | 1 | 10 | 4 | 36 | 1 | | Mac | GGTGTCGCCGACTTGGGATCAAA | 20 | 0 | 1 | 0 | 0 | 36 | 1 | | Max R. | CGTCGCGATAAGTCACTGGAGCG | 20 | 0 | 1 | 0 | 0 | 32 | 1 | | microstn'd | CATAGTCGAAGGGTATGCTCCAC | 20 | 0 | 1 | 4 | 1 | 36 | 1 | | Oloros | TAAGATTTAAGCGCGCCTTTCGA | 20 | 0 | 1 | 10 | 2 | 36 | 1 | | Pulp | ACCAGGCAGCAACTAAAAGCGTA | 20 | 0 | 1 | 3 | 2 | 36 | 1 | | Raven | TCTTCAGCCATCTGGTATAACTA | 20 | 0 | 1 | 10 | 3 | 36 | 1 | | TopHeavy | CAATCTTGTACTGGCATGTCCCA | 20 | 0 | 1 | 0 | 0 | 0 | 0 | | TwistedOne | CGTCGACTGCAGTACCAGGTCAC | 20 | 0 | 1 | 7 | 1 | 2 | 1 | | Tyrethali | CATAGAGGCCGTAGATCCATAAC | 20 | 0 | 1 | 1 | 0 | 36 | 1 | | Xylen | AGCAGCCCATCCATAAATGGGCT | 20 | 0 | 1 | 7 | 2 | 36 | 1 | +------------+-------------------------+----+----+----+----+----+----+- ----+ (Note that "Proposals Made" includes Proposals submitted in Week One and Week Two. Phenotypes to follow when I've written some code to generate them; feel free to work them out by hand in the mean-time. Tower blueprints to be put on the Web page when I have a moment.) ----------------------------------------------------------------------- ------ FOOTNOTES ----------------------------------------------------------------------- ------ * All Players will be assigned and informed of their user names and passwords shortly. As part of this Proposal, RavenBlack may make one extra Proposal in Week 3. ** Initial temperature = 280 + 15 = 295 Kelvs *** Have twenty Sludge, everyone. + You're all Missing Links. I'll draw the Tree of Life properly when people start nominating. ++ True to prediction, this has overwritten the username/password perl-script amendment to Rule 6 (Votes). Do pay attention. +++ The Twisted One chose to cast 11 votes AGAINST Proposal 1, and 25 FOR Proposal 4, interpreting "a Player may cast one Vote for every Proposal" as "a Player may cast 'x' votes, where 'x' is the number of Proposals". The Speaker didn't feel this was specifically against the Rules, and permitted it. From Mon Mar 27 04:47:17 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 12:47:35 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 21723 invoked from network); 27 Mar 2000 12:47:34 -0000 Received: from cj.egroups.com (10.1.2.82) by iqg.egroups.com with SMTP; 27 Mar 2000 12:47:34 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.26] by cj.egroups.com with NNFMP; 27 Mar 2000 12:47:33 -0000 Date: Mon, 27 Mar 2000 04:47:30 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bnl92$dahu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Week Three Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit +-------------------------------------------------------+ | GENOMIC PROPOSALS - Year One, Week Three | +-------------------------------------------------------+ ----------------------------------------------------------------------- ------ Proposal 037 - The Brutish Gene 1. Lamp Check If Proposal 010 (Gene Genie), didn't pass, this Proposal shall have no effect, and Kevan shall mutter darkly to himself. 2. You Need Hands (and Skin, and Ears) Add the following new Genes (unless any of the proposed Gene numbers are used by other Proposals this Week, in which case these numbers should be randomised to unused Genes):- Gene 8 - Skin A : Player is Slightly Hairy. C : Player is Very Hairy. G : If Gene 23 is A/G: Player has Feathers. If Gene 23 is C/T: Player has Chameleonic Scales. T : Player has Thick Leathery Skin. Gene 9 - Hearing A : Player is Deaf. C : Player has low-range Hearing. G : Player has high-range Hearing. T : Player has pinpoint Echolocation. Gene 10 - Hands A : Player has no Hands. C : Player has Hands with razor-sharp Claws. G : If Gene 8 is A/G: Player has opposable-thumb Hands. If Gene 8 is C/T: Player has Paws. T : Player has Tentacles. In each Player's DNA, set the above Genes, whatever their numbers may end up as, to random values. (This will avoid people voting for or against this Proposal on the basis of their current genotype. As someone or other said, the best society would be one that was planned with nobody knowing which role they'd end up playing in it.) 3. Call to Arms Amend an old Gene:- Gene 5 - Arms A : Player has no Arms. The "Hands" Gene automatically becomes "A". CG : Player has two Arms. T : Player has four Arms, or eight if Player also has Tentacles. 4. The Meaning of Lunch If the Rule "Survival of the Fittest" exists, reword it to the following indented text. Otherwise, enact such text as a new Rule, called "Survival of the Fittest":- A Player may attempt to Eat another Player by declaring this desire on the mailing list in a message with the subject line "Eating " (where "" is the name of any other Player), unless the Eating Player has Eaten another Player already this Week. (Players may not Eat other Players during the Interregnum.) When a Player attempts to Eat another Player, the Eating Player should calculate total Attack and Evasion Modifiers for themselves and their victim, from the following table, based on each Player's phenotype. The Attack Modifier is greater than the Evasion Modifier, the Eating Player has successfully Eaten their victim. If less than the Evasion Modifier, the Eating Player has instead been Eaten by their victim. If both Modifiers are equal, nothing happens. +-------------------------------------------------------+----------- -+ | Phenotypic Aspect | Modifier | +-------------------------------------------------------+----------- -+ | Claws | +2 Attack | | Huge Pointy Teeth | +2 Attack | | Beak | +1 Attack | | Huge in Size (unless victim is also Huge) | +2 Attack | | Echolocation | +1 Attack | | Wings (unless victim also has Wings) | +1 Attack | +-------------------------------------------------------+----------- -+ | Tiny in Size (unless victim is also Tiny) | -5 Attack | | No Legs | -2 Attack | | No Eyes (unless Player has Echolocation) | -3 Attack | | Deaf | -1 Attack | +-------------------------------------------------------+----------- -+ +-------------------------------------------------------+----------- -+ | Phenotypic Aspect | Modifier | +-------------------------------------------------------+----------- -+ | Paws | +1 Evasion | | Thick Leathery Skin | +2 Evasion | | Chameleonic Scales (unless attacker has Echolocation) | +3 Evasion | | Tiny in Size (if attacker is Small) | +1 Evasion | | Tiny in Size (if attacker is Large or Huge) | +4 Evasion | | Echolocation | +1 Evasion | | Wings (unless attacker also has Wings) | +9 Evasion | +-------------------------------------------------------+----------- -+ | No Legs | -2 Evasion | | No Eyes (unless Player has Echolocation) | -3 Evasion | | Deaf | -3 Evasion | +-------------------------------------------------------+----------- -+ 5. The Middle One Repeal any Rule entitled "How Not To Be Eaten". ----------------------------------------------------------------------- ------ Proposal 038 - What, the Curtains? At any point during the Week, if they have not already done so that Week, a Player may privately announce to the Speaker that they are stepping back to let one of their offspring take over. Upon such an announcement, the Speaker shall determine a DNA String for this child - the parent's DNA with two genes adjusted at random - and inform the Player of this String. The Player may then choose whether to let his or her child take over (in which case the Player alerts the mailing list and the Player's DNA becomes the child's DNA) or change their mind (the child is pushed away and the Player's DNA remains unaltered). ----------------------------------------------------------------------- ------ Proposal 039 - In Veto Veritas (This gives certain Players the ability to veto a single Proposal. Such a power is only granted to Players who prove themselves to be particularly in-tune with the populace.) 1. Power Charging, Expenditure Enact a new Rule, "In Veto Veritas":- Players may possess the Power of Veto. During each Interregnum, any Players who voted FOR all Proposals that passed and AGAINST all Proposals that failed will gain the Power of Veto. Any Player who voted VETO to a Proposal will lose the Power of Veto. 2. Da Veto To Rule 6 (Votes), add the sentence:- If a Player possesses the Power of Veto, he or she may instead cast a vote of "VETO" for one Proposal, each Week. 3. Bullets Fly To Rule 7 (The Interregnum), add "If a Proposal receives any 'VETO' Votes, however, it fails." to the end of the first bullet point, and add a new bullet-point at the end; "Determine and announce the Players that have been granted the Power of Veto." ----------------------------------------------------------------------- ------ Proposal 040 - I've come over all aquiver Rule 7 shall be modified to read: During the Interregnum, the following things shall happen, in the following order:- a. The Speaker shall examine all legal Votes cast during the Week to determine which Proposals pass. If a Proposal receives more FOR Votes than AGAINST Votes, it passes. b. If a proposal receives an equal number of FOR and AGAINST votes, then it shall be resubmitted for further voting the during the next week. If a proposal receives an equal number of FOR and AGAINST votes two weeks running, then it shall be discarded c. The Speaker shall update the Ruleset to reflect passed Proposals. d. The Speaker shall post Voting results to the Mailing List, and the updated Ruleset to the Genomic Web Page. e. The Speaker shall gather all legal Proposals submitted during the previous Week, and post them to the Mailing List. When all of these tasks has been performed, the Interregnum ends. ----------------------------------------------------------------------- ------ Proposal 041 - Week Lemon Drink Replace the body of Rule 4 with the following: Genomic is played in terms of Weeks. A Week may end at 1:00pm (GMT) on either a Monday or a Thursday. For a Week to end, either 1. It must have been 7 days since the previous Week ended. or 2. There must be at least 15 Proposals made since the current Week started. With condition 1, the Week _must_ end. With condition 2, it _may_ end, at the Speaker's discretion. The end of a Week is followed by the Interregnum, during which the Speaker does appropriate paperwork. The Interregnum ends and new Week starts when the Speaker sends out the Proposals from the Week which just ended. {Two effects here - one is to define the end of an Interregnum, which was left slightly loose. The other is to potentially speed the game up, if, and only if, it doesn't inconvenience the Speaker too much.} ----------------------------------------------------------------------- ------ Proposal 042 - Exhaust Fumes Enact a new Rule entitled "Life Time", the body of which shall read: Any passed Proposal may be rejected by the Speaker if its being enacted would create an unreasonable amount of work. The Speaker must declare this to the list upon the Proposal passing. To minimise abuse by the Speaker, if a third or more of the Players state to the mailing list that they believe the Proposal would _not_ have created an unreasonable amount of work, the Proposal shall take effect from the beginning of the next week. The Speaker will then have the right to delegate as much of the work as possible to the Player who sent the first of the dissenting messages. ----------------------------------------------------------------------- ------ Proposal 043 - Simple Constructs Modify Rule 6 - Votes - appending "The Vote Score of a Proposal is defined as the number calculated by subtracting the number of AGAINST Votes from the number of FOR Votes for that Proposal. The Vote Strength of a Proposal is defined as the number calculated by dividing the Vote Score by the total number of Votes cast for that Proposal." ----------------------------------------------------------------------- ------ Proposal 044 - Survival of the For-est Enact a new Rule entitled "Survival of the Fittest", the body of which shall read: If two or more Proposals pass in the same Week which will modify the same Rule in exclusive ways (ie. after the modifications, one of the modifications will have been obscured), only the modification with the higher Vote Score will be made. This does not necessarily prevent the other Proposal's effects upon other Rules. If the Proposal "Simple Constructs" did not Pass, replace "Vote Score" in the above paragraph with "FOR/AGAINST Vote ratio". ----------------------------------------------------------------------- ------ Proposal 045 - Scaled Votes Enact a new Rule, entitled "Scaled Votes", the body of which shall read: As well as "FOR", "AGAINST" and "PASS", there are two other ways a Player can Vote on a Proposal; "MM" and "NAH". A Vote of "MM" is equal in every way to one-half of a Vote of "FOR" and one-half of a Vote of "PASS". A Vote of "NAH" is equal in every way to one-half of a Vote of "AGAINST", and one-half of a Vote of "PASS". ----------------------------------------------------------------------- ------ Proposal 046 - No dot coms here Proposals shall be numbered as [year]/[week]/[proposal number], where [year] and [week] are the Genomic year and week that the proposal is posted to the mailing list. The [proposal number] is the number assigned by the Speaker to that proposal. Proposals may be referred to by using [week]/[proposal number] when the [year] is unambiguously known, or by just [proposal number] when both the [year] and [week] are unambiguously known. ----------------------------------------------------------------------- ------ Proposal 047 - Time is on your side (of the ocean) Whenever a specific time is mentioned in the rules, it shall be understood to refer to GMT (Greenwich Mean Time) unless otherwise specified. ----------------------------------------------------------------------- ------ Proposal 048 - 20,000 Leagues and other Horrors The following are additions to the known gene effects. Gene 15 - End of Arms(Hands) AC : Player has tentacles. G : Player has cilia. T : Player has a hand. If a player has Gene 5 A, then the effects of Gene 15 occur at the location where an arm appears with Gene 5 CG or Gene 5 T. When a player has Gene 20 A, that player cannot use lower case letters in any message sent to the mailing list. (If a player can't see very well, they need to use capital letters to make certain that they can see their own words. This gene is prevalent among users of certain newsgroups and mailing list, so it is expected to exist among the players of Genomic as well. Due to the high regard for the Speaker, and with extreme concentration, those with this gene are capable of using lowercase letters in correspondences to the Speaker.) If there is no rule titled Gene Genie, then this proposal shall have no effect. ----------------------------------------------------------------------- ------ Proposal 049 - Donald Trump Real Estate If there exists a Rule titled "Towers of Law" then it shall be amended to read as follows: There exists a foundation for an office building known as The Tower of Law (The Tower). This foundation consists of 8 floors, number 1 to 8. These 8 floors belong to the Speaker at the start of the Genomic. For each proposal that creates a new Rule and is successfully voted in, a new floor is added to the top of The Tower, belonging to the proposing player. Each floor in the Towers of Law is numbered. This number is the Rule number given to a Rule by the successful passage of a proposal. If a proposal amends a Rule, then the former owner of that floor is evicted, and the new owner of the floor is the author of the successful amendment. If a proposal deletes a Rule from the ruleset, then the floor corresponding to that rule is declared Abandoned, and no one may own it. Each floor has one large window. Only the owner of a floor may open or close this window. All windows are closed unless the mailing list is specifically informed that the window is open. A player may hurl his/herself from the open window of any floor they own, and from there may do one of the following: fall to the ground, or zip into an open window of a lower floor. There is an elevator in The Tower that allows a player access to any floor owned by that player. ----------------------------------------------------------------------- ------ Proposal 050 - Your Vote can make a difference, should TheTwistedOne allow it! In Rule 6 (Votes), replace the sentence "During a given Week, each Player may cast one Vote for every Proposal that was distributed by the Speaker at the start of that Week." with "During a given Week, each Player may cast one Vote with regards to each Proposal that was distributed by the Speaker at the start of that Week." ----------------------------------------------------------------------- ------ Proposal 051 - Does somebody need a hug? (or, "I don't love you anymore") {If proposal 022 is passed, then amend it to as such:} There exists a game entity known as the Teddy Bear. The Teddy Bear is an eligible voter, but not a player. the Teddy Bear is initially given to the newest player. Whenever the Teddy Bear may vote, it votes the same as it's owner. When a new player joins, they may try to take control of the teddy bear. The current owner of the teddy bear must submit, to the speaker, a reason to keep the teddy bear. The new player must submit a reason why they deserve the teddy bear, also to the speaker. The Speaker will then inform all the players of the two reasons (anonymously) All players may then cast one, for each of the reasons to keep the teddy bear. The person who gains the most votes receives the teddy bear. If the votes are equal, then the new player will gain control of the bear {If it is not passed, then the previous text is proposed as the new proposal} ----------------------------------------------------------------------- ------ Proposal 052 - Keeping abreast Any attributes or statistics of, or items owned by a player, will be submitted to the list by the speaker at the same time as the new proposals ----------------------------------------------------------------------- ------ Proposal 053 - The Espousal of Special Particulars Each Player shall have a decimal number, known as eir Esper Rating. This number shall be calculated each Week, based on the ratio of the number of Proposals submitted by that Player which passed to the number of Proposals submitted by that Player. Each week, the Player with the highest Esper Rating shall be awarded one Charm Point. If more than one Player has the highest Esper Rating, those Players (two or more) shall each receive one-half Charm Point. Any Player with 7 or more Charm Points may refer to emself as "charming" in any Genomic correspondence, and may make one extra Proposal per Week. The following Paragraph shall be added to Rule 7 where appropriate: "The Speaker shall calculate the Esper Rating and administer the award of Charm Points for each Player, and post such information to the mailing list." ----------------------------------------------------------------------- ------ Proposal 054 - Standing on the Shoulders of Giants, or All's Swell That Ends Swell Should a Victory Condition obtain, and a Winner be declared, each Rule of the Ruleset shall be called to Vote for inclusion in the Initial Ruleset of the next Era of Genomic. This Proposal tantalizingly hints at definitions and ideas yet to be discussed. It is submitted as a prelude to such discussion, even though it may be seem rather early. This paragraph is commentary and may be struck from the text of this Rule if enacted. ----------------------------------------------------------------------- ------ Proposal 055 - Sign Here, Please Caudal to any posting to the mailing list by a Player must be appended the Signature of that Player. This Signature shall include that Player's Name and any descriptive information (adjectival, not necessarily numeric) currently applicable to that Player. To neglect to append one's Signature, or to include false or misleading information in one's Signature, is to be considered a trespass of protocol, and an upset. ----------------------------------------------------------------------- ------ Proposal 056 - Abstemiousness Passing Regards The first paragraph of Rule 6 will be changed to read: "At the start of a given Week, the Speaker shall distribute a list of anonymous Proposals. Each Player may cast one Vote for each Proposal on this list. This Vote may be one of the following: "FOR", "AGAINST", "ABSTAIN", or, "PASS". Any other response shall be considered a Vote of "ABSTAIN", but, if a comment of reasonable length, may at the Speaker's discretion, be forwarded to the mailing list as anonymous commentary. The absence of a Vote from any Player shall be considered as a Vote of "PASS". " ----------------------------------------------------------------------- ------ Proposal 057 - Groove is in the House The Vote on a Proposal shall not be considered valid if more that 50% of Players cast a Vote of "PASS". ----------------------------------------------------------------------- ------ Proposal 058 - I didn't do it, nobody saw me, and you can't prove anything! Amend Rule 5 by adding the following paragraph: Players may Retract their own proposals at any time before the end of the Week after they were proposed, by posting a message to the mailing list containing the test "I Retract the following Proposal" and the name of the Proposal to be Retracted. Retracted Proposals do not count as Proposals for any aspect of the game (e.g. statistics, cereal box tops etc). The Retracting Player does not regain a Proposal for that Week. ----------------------------------------------------------------------- ------ Proposal 059 - Patches on the Fly Amend Rule 5 by adding the following paragraph: "Players may Modify their own Proposal at any time before the end of the Week after they were proposed, by posting a message to the mailing list containing the text "I Modify the following Proposal", the name of the Proposal to be Modified, and the Modifications to the Proposal. If, in the opinion of the Speaker, the Modification has changed the spirit of the Proposal, the Modifying Player loses one Proposal for that week." ----------------------------------------------------------------------- ------ Proposal 060 - For the Term of Its Natural Life Enact a new Rule: Each Rule has a property called "Age" and a property called "Lifetime", which are appended to their titles in the Ruleset. When a new Rule is Enacted, its Age is set to zero. During each Interregnum, the Ages of all Rules are increased by one. When a new Rule is Enacted, its Lifetime is set to the Seniority of the Player who proposed it, plus the number of FOR votes it received. Rules generated by other Rules have their Lifetime set to that of the Rule which generated them. When a Rule is Modified, its Lifetime is increased by the number of FOR votes the Proposal of modification received. If the difference between the Age and Lifetime of a Rule is less than three, that Rule shall be declared Senile. the effects of Senile Rules may be overturned by a Call for Justice If the Age of a Rule equals its Lifetime, that Rule shall be deleted from the Ruleset. When this Rule is Enacted, all existing Rules will have their Age set to zero. Rules 1-8 will have their Lifetime set to 52. All other Rules will have their lifetime set to 15. This paragraph will then delete itself. ----------------------------------------------------------------------- ------ Proposal 061 - Bring out the GIMP Enact a new rule: The Genomic Integrity Monitoring Panel (GIMP) can be called on to protect Genomic from its own Rules. The GIMP can be convened only if two or more Players privately email the Speaker stating that they believe a specified Rule is endangering the safety of Genomic, and they wish to "bring out the GIMP". The Speaker will then select three Players at random (not from those who called out the GIMP) to form a GIMP to consider the effects of the specified Rule. If the GIMP decides unanimously, within 48 hours or before the next Interregnum, whichever is the shorter, that the Rule is endangering the integrity of Genomic, that Rule will be Silenced by enclosing its text in Comment braces {}. The GIMP may only be brought out once a week. ----------------------------------------------------------------------- ------ Proposal 062 - There is Only One Thing Worse than Being Witty Enact a new Rule: Each Week, each Player may nominate one Proposal as the "Wittiest Proposal of the Week" The Proposal that receives the most nominations will be known as the "Wittiest Proposal of Week N" where N is the week it was submitted. If no single Proposal has the most nominations, the Speaker shall select the Wittiest Proposal at random from those with the most nominations. The Wittiest Proposal and the name of the Player who Proposed it shall be posted by the Speaker to the mailing list. The Player who proposed the Wittiest Proposal of Week N gets and extra Proposal in Week N+2. ----------------------------------------------------------------------- ------ Proposal 063 - Back to Basics { It seems sensible to have some rudimentary mechanics governing objects and locations. Hopefully they tread the divide between strict definition and readability in a balanced way. } Enact the following text as a rule titled "Object lesson". There may exist Objects, possibly also referred to as Entities, or Things. Objects may only be created, moved, or destroyed as described in the rules. All Objects have a name. Objects may contain other Objects. These Objects are called Containers. If at any time an Object is not in a Location, it is moved to Limbo. Enact the following text as a rule titled "You are here". There exist a number of Locations, which are Container Objects. Locations may never be contained within other Objects. A Location may be connected to any number of other Locations. If a connection exists from one Location to a second, then a corresponding connection is created (if it doesn't already exist) from the second Location to the first. A Player may move to a Location by publically announcing they are doing so, and stating their destination. If there exists a pathway between that Player's current Location and their stated destination, they are moved to the destination. A 'pathway', in this context, is a series of Connections between locations. Create a Location, named "Genomic Hub", and move all Players there. Create a Location named "Limbo". { Let's make some map... } All players may create exactly one Location, by publically stating they are doing so, and providing a name for the Location. They may then create a connection between that Location and any other existing Location. ----------------------------------------------------------------------- ------ Proposal 064 - Ludicrous, dangerous insanity. Every week, immediately following the Interregnum, two random noun phrases are chosen from the Ruleset and exchanged with each other. (A noun phrase consists of an optional article, any number of adjectives, and a noun, in that order.) ----------------------------------------------------------------------- ------ Proposal 065 - Moooooooooo! If Proposal 004 (Megalomaniacs Anonymous) became a Rule, replace the title and text of that Rule with the text and title of this Proposal, minus this paragraph. TheTwistedOne is to be referred to as "The infeasibly large dairy product, in charge of all the paperclips". This Rule shall be automatically repealed during the next Interregnum. ----------------------------------------------------------------------- ------ Proposal 066 - Hopeful Monsters Far out to the east of what can loosely be termed "civilisation", the lush grassland of Genomic fades to barren, dusty earth, the rich fauna faltering to an array of wretched, mutant plantlife, with the odd malformed creature loping from rock to rock. It is believed that this part of the world was the site of an ancient meteor strike, or a long-forgotten nuclear disaster. A Player weary of his or her genetic lot may venture out into this radioactive desert to give birth to a mutant child, before themselves succumbing to the deadly poisons and radiations. If a Player announces such an intention on the mailing list - and provided they have not done this already during the current calendar month - they are replaced by their heavily mutated offspring, signified by that Player's DNA being entirely randomised. ----------------------------------------------------------------------- ------ Proposal 067 - A Brief Mystery of Time { This has pushed in front of my grumpy "Proposals *must* be sent to the Speaker" Proposal, since it's something that we really need to be clear on; a few Proposals last week put forward things which would happen "at the end of the Interregnum", which seems a needlessly bad and ambiguous thing when Rule 7 already has a neat list of Interregnum stuff, clearly specifying the order of things. This is proposed as a Rule rather than a one-off amendment, for the benefit of future carelessnesses (and, I suppose, to spare Proposers the bother of explicitly updating Rule 7 every time they add something). } If a Rule refers to something happening during the Interregnum, but such a happening isn't given in the bulleted list of Rule 7 (The Interregnum), the Speaker may add that thing to said list, at a position of his or her choosing. Rules which refer to something occurring "at the end of the Interregnum" may be reworded to happen "during the Interregnum". ----------------------------------------------------------------------- ------ From Mon Mar 27 04:55:04 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 12:55:22 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 27693 invoked from network); 27 Mar 2000 12:55:19 -0000 Received: from mq.egroups.com (10.1.1.36) by iqg.egroups.com with SMTP; 27 Mar 2000 12:55:19 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.124] by mq.egroups.com with NNFMP; 27 Mar 2000 12:55:19 -0000 Date: Mon, 27 Mar 2000 04:55:12 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bnlng$4v2v@e...> In-Reply-To: <20000327124304.32245.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Hmmm. Let's get picky now. Splendid. > "During a given Week, each Player may cast one Vote for every Proposal that was distributed by the Speaker at the start of that Week. This Vote may be either "FOR", "AGAINST" or "PASS"." > > Hmmm. You may "cast one Vote for every Proposal" It doesn't actually mention that you can cast Votes against proposals at all. This seems a fair argument, that if The Twisted One is arguing that "one Vote for every Proposal" means "one Vote per Proposal" rather than "one Vote on each Proposal", it removes the explanation of what you're actually supposed to do with the Votes. That "Vote" is a capitalised word, though (and thus game-specific, according to Rule 1), makes it - I'd say - safe to infer from Rule 7 (The Interregnum) that Votes can be cast upon Proposals. Time to invoke Rule 8 (Justice), maybe? Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 27 05:03:06 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:03:24 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 1703 invoked from network); 27 Mar 2000 13:03:21 -0000 Received: from ck.egroups.com (10.1.2.83) by iqg.egroups.com with SMTP; 27 Mar 2000 13:03:21 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.124] by ck.egroups.com with NNFMP; 27 Mar 2000 13:03:21 -0000 Date: Mon, 27 Mar 2000 05:03:16 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bnm6k$4v6g@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Everything Else MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Rather than spam the mailing list *too* much, the new Ruleset has just been posted up on the Web page (http://www.crosswinds.net/~genomic/rule set.html); I'll add some more detailed pages for DNA details and Tower floorplans when the time avails itself - later tonight, quite possibly. Feel free to complain if I've added up someone's details incorrectly, or overlooked anything. Kevan (small, two Arms, four Legs, chameleon-Eyes and Huge Pointy Teeth) -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 27 05:07:39 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:07:58 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 20373 invoked from network); 27 Mar 2000 13:07:43 -0000 Received: from oe43.law7.hotmail.com (HELO hotmail.com) (216.33.236.79) by mx3.egroups.com with SMTP; 27 Mar 2000 13:07:43 -0000 Received: (qmail 36886 invoked by uid 65534); 27 Mar 2000 13:07:43 -0000 Message-ID: <20000327130743.36885.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnm6k$4v6g@e...> Date: Mon, 27 Mar 2000 14:06:23 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0034_01BF97F5.A2349540" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0034_01BF97F5.A2349540 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable *poof* There goes my enthusiasm. ------=_NextPart_000_0034_01BF97F5.A2349540 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
*poof*
 
There goes my enthusiasm.
 
 
------=_NextPart_000_0034_01BF97F5.A2349540-- From Mon Mar 27 05:32:58 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:33:16 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 13624 invoked from network); 27 Mar 2000 13:33:14 -0000 Received: from fg.egroups.com (10.1.2.134) by iqh.egroups.com with SMTP; 27 Mar 2000 13:33:14 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.128] by fg.egroups.com with NNFMP; 27 Mar 2000 13:33:13 -0000 Date: Mon, 27 Mar 2000 05:33:08 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnnuk$c1s1@e...> In-Reply-To: <8bnlng$4v2v@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > > "During a given Week, each Player may cast one Vote for every > Proposal that was distributed by the Speaker at the start of that Week. > This Vote may be either "FOR", "AGAINST" or "PASS"." > > > > Hmmm. You may "cast one Vote for every Proposal" It doesn't actually > mention that you can cast Votes against proposals at all. > > This seems a fair argument, that if The Twisted One is arguing that > "one Vote for every Proposal" means "one Vote per Proposal" rather than > "one Vote on each Proposal", it removes the explanation of what you're > actually supposed to do with the Votes. What is being claimed is that "for"=="FOR", which isn't true. If Votes could be "for", "against" or "pass", then I would agree with this, because it would amuse me. But it doesn't. My point with 001 was that there is a flaw, which comes about through the Rule being ambiguously worded. Ignore that ambiguity, and the purpose of the Rule is clear. > Time to invoke Rule 8 (Justice), maybe? Heh. And twas, of course, me that Proposed to repeal that same Rule. --TheTwistedOne From Mon Mar 27 05:34:27 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:34:46 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 25397 invoked from network); 27 Mar 2000 13:34:44 -0000 Received: from ci.egroups.com (10.1.2.81) by iqg.egroups.com with SMTP; 27 Mar 2000 13:34:44 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.128] by ci.egroups.com with NNFMP; 27 Mar 2000 13:34:44 -0000 Date: Mon, 27 Mar 2000 05:34:42 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bno1i$c1t0@e...> In-Reply-To: <8bnm6k$4v6g@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Everything Else MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > been posted up on the Web page (http://www.crosswinds.net/~genomic/ru le > set.html); I'll add some more detailed pages for DNA details and Tower [grins] Hurrah for a system that word-wraps hrefs improperly! Huzzah! --TheTwistedOne From Mon Mar 27 05:39:36 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:39:54 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 29572 invoked from network); 27 Mar 2000 13:39:52 -0000 Received: from oe18.law7.hotmail.com (HELO hotmail.com) (216.33.236.122) by qg.egroups.com with SMTP; 27 Mar 2000 13:39:52 -0000 Received: (qmail 41058 invoked by uid 65534); 27 Mar 2000 13:39:52 -0000 Message-ID: <20000327133952.41057.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnnuk$c1s1@e...> Date: Mon, 27 Mar 2000 14:38:32 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0010_01BF97FA.1FEBF9C0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0010_01BF97FA.1FEBF9C0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > > "During a given Week, each Player may cast one Vote for every > Proposal that was distributed by the Speaker at the start of that Week. > This Vote may be either "FOR", "AGAINST" or "PASS"." > > = > > Hmmm. You may "cast one Vote for every Proposal" It doesn't actually > mention that you can cast Votes against proposals at all. > = > This seems a fair argument, that if The Twisted One is arguing that > "one Vote for every Proposal" means "one Vote per Proposal" rather than > "one Vote on each Proposal", it removes the explanation of what you're > actually supposed to do with the Votes. What is being claimed is that "for"=3D=3D"FOR", which isn't true. If Vote= s could be "for", "against" or "pass", then I would agree with this, because it would amuse me. But it doesn't. Idiot. Let me use smaller words. "During a given Week, each Player may cast one Vote for every Proposal th= at was distributed by the Speaker at the start of that Week. This Vote may = be either "FOR", "AGAINST" or "PASS"." Hmmm. You may "cast one Vote for every Proposal" It doesn't actually ment= ion that you can cast Votes **with regards to** >>proposals<< at all. ------=_NextPart_000_0010_01BF97FA.1FEBF9C0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
> > "During a given Week, each Player may cast one Vote for = every
> Proposal that was distributed by the Speaker at the start o= f = that
Week.
> This Vote may be either "FOR", "AGAINST" or = "PASS"."
> >
> > Hmmm. You may "cast one Vote for ever= y = Proposal" It doesn't actually
> mention that you can cast Votes aga= inst = proposals at all.
>
> This seems a fair argument, that if Th= e = Twisted One is arguing that
> "one Vote for every Proposal" means "= one = Vote per Proposal" rather
than
> "one Vote on each Proposal", it= = removes the explanation of what you're
> actually supposed to do wi= th = the Votes.
What is being claimed is that "for"=3D=3D"FOR", which isn't= true. If = Votes
could be "for", "against" or "pass", then I would agree with = this,
because it would amuse me. But it doesn't.
Idiot. Let me use smaller words.
 
"During a given Week, each Player may= cast = one Vote for every Proposal that was distributed by the Speaker at the st= art = of that Week. This Vote may be either "FOR", "AGAINST" or = "PASS"."

Hmmm. You may "cast one Vote for every Proposal" It doesn= 't = actually mention that you can cast Votes **with regards to** = >>proposals<< at all.
 
------=_NextPart_000_0010_01BF97FA.1FEBF9C0-- From Mon Mar 27 05:44:49 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:45:07 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 390 invoked from network); 27 Mar 2000 13:45:04 -0000 Received: from cj.egroups.com (10.1.2.82) by iqg.egroups.com with SMTP; 27 Mar 2000 13:45:04 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.24] by cj.egroups.com with NNFMP; 27 Mar 2000 13:45:04 -0000 Date: Mon, 27 Mar 2000 05:44:56 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnoko$881p@e...> In-Reply-To: <20000327130743.36885.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "adam s" wrote: original article:http://www.egroups.com/group/genomic/?start=120 > *poof* > > There goes my enthusiasm. I spotted the flaw, Proposed to plug it (and got lambasted for it, albeit anonymously), abused it, and now have attempted to fix in what I had hoped would be taken good-naturedly. I'm not in the business of spoiling games. Obviously not, eh. I shan't be using my "power". Call for Justice if you want (which may or not work), or Vote FOR this Proposal (which will work). Next Week, Rule 9 will become nonsense, and the Week after that, it will no longer exist. Hardly the work of a vicious dictator, is it? --TheTwistedOne From Mon Mar 27 05:49:41 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:50:00 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 4112 invoked from network); 27 Mar 2000 13:49:50 -0000 Received: from oe32.law7.hotmail.com (HELO hotmail.com) (216.33.236.27) by qg.egroups.com with SMTP; 27 Mar 2000 13:49:50 -0000 Received: (qmail 81376 invoked by uid 65534); 27 Mar 2000 13:49:50 -0000 Message-ID: <20000327134950.81375.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnoko$881p@e...> Date: Mon, 27 Mar 2000 14:47:57 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0024_01BF97FB.70F23450" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0024_01BF97FB.70F23450 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable I'm missing about 20 hours sleep, so I'm not taking anything good naturedly= today. So there. *slaps you and runs away* ----- Original Message ----- = From: TheTwistedOne = To: genomic@e... = Sent: Monday, March 27, 2000 2:44 PM Subject: [genomic] Re: The infeasibly large dairy product, in charge of a= ll the paperclips "adam s" djarca-@h... wrote: original article:http://www.egroups.com/group/genomic/?start=3D120 > *poof* > > There goes my enthusiasm. I spotted the flaw, Proposed to plug it (and got lambasted for it, albeit anonymously), abused it, and now have attempted to fix in what I had hoped would be taken good-naturedly. I'm not in the business of spoiling games. Obviously not, eh. I shan't be using my "power". Call for Justice if you want (which may or not work), or Vote FOR this Proposal (which will work). Next Week, Rule 9 will become nonsense, and the Week after that, it will no longer exist. Hardly the work of a vicious dictator, is it? --TheTwistedOne ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0024_01BF97FB.70F23450 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
I'm missing about 20 hours sleep, so I'm not taking any= thing = good naturedly today.
 
So there. *slaps you and runs away*
----- Original Message -----
Fro= m: = TheTwistedOne
Sent: Monday, March 27, 2000 2:44 = PM
Subject: [genomic] Re: The infeasi= bly = large dairy product, in charge of all the paperclips

"adam s" djarca-@h... wrote:
original article:http://www.egroups.com/group/genomic/?start=3D120
> *poof*
>
> There goes my enthusiasm.

I spotted the flaw, Proposed to plug it (and got lambasted for it,
albeit anonymously), abused it, and now have attempted to fix in what I
had hoped would be taken good-naturedly. I'm not in the business of
spoiling games.

Obviously not, eh.

I shan't be using my "power". Call for Justice if you want (which may
or not work), or Vote FOR this Proposal (which will work). Next Week,
Rule 9 will become nonsense, and the Week after that, it will no longer
exist. Hardly the work of a vicious dictator, is it?

--TheTwistedOne



To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0024_01BF97FB.70F23450-- From Mon Mar 27 05:54:40 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 13:54:59 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 30312 invoked from network); 27 Mar 2000 13:54:56 -0000 Received: from mr.egroups.com (10.1.1.37) by iqh.egroups.com with SMTP; 27 Mar 2000 13:54:56 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.26] by mr.egroups.com with NNFMP; 27 Mar 2000 13:54:56 -0000 Date: Mon, 27 Mar 2000 05:54:47 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnp77$qqc6@e...> In-Reply-To: <20000327133952.41057.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Two Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit "adam s" wrote: original article:http://www.egroups.com/group/genomic/?start=123 > > > "During a given Week, each Player may cast one Vote for every > > Proposal that was distributed by the Speaker at the start of that > Week. > > This Vote may be either "FOR", "AGAINST" or "PASS"." > > > > > > Hmmm. You may "cast one Vote for every Proposal" It doesn't actually > > mention that you can cast Votes against proposals at all. > > > > This seems a fair argument, that if The Twisted One is arguing that > > "one Vote for every Proposal" means "one Vote per Proposal" rather > than > > "one Vote on each Proposal", it removes the explanation of what you're > > actually supposed to do with the Votes. > What is being claimed is that "for"=="FOR", which isn't true. If Votes > could be "for", "against" or "pass", then I would agree with this, > because it would amuse me. But it doesn't. > > Idiot. Let me use smaller words. > > "During a given Week, each Player may cast one Vote for every Proposal that was distributed by the Speaker at the start of that Week. This Vote may be either "FOR", "AGAINST" or "PASS"." > > Hmmm. You may "cast one Vote for every Proposal" It doesn't actually mention that you can cast Votes **with regards to** >>proposals<< at all. Ah. Yes. I see your point now. You could just as easily cast a Vote FOR fish fingers for tea. It doesn't mean you can't cast them as Votes upon Proposals, though. Nor does it prevent Proposal 004 having become a Rule. Which makes Proposal 001 (and whichever the re-issue became) doubly important, I think. --TheTwistedOne From Mon Mar 27 06:02:04 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:02:22 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 3158 invoked from network); 27 Mar 2000 14:02:17 -0000 Received: from ml.egroups.com (10.1.1.31) by iqh.egroups.com with SMTP; 27 Mar 2000 14:02:17 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.124] by ml.egroups.com with NNFMP; 27 Mar 2000 14:02:17 -0000 Date: Mon, 27 Mar 2000 06:02:14 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnpl6$73si@e...> In-Reply-To: <20000327134950.81375.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > So there. *slaps you and runs away* [quivers slightly] Ooh. Again, again! [breathes in] Can you at least that I spotted a very real flaw (and missed another, which my Proposal covers anyway), Proposed to fix it, abused it for amusement, decided that it maybe wasn't in the spirit of things to kill the game by the end of the second Week, and have taken steps to fix it, in a "don't hate me" stylee? [collapses on the floor, hyperventilating] --TheTwistedOne From Mon Mar 27 06:05:51 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:06:08 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 6336 invoked from network); 27 Mar 2000 14:06:07 -0000 Received: from oe14.law7.hotmail.com (HELO hotmail.com) (216.33.236.118) by qh.egroups.com with SMTP; 27 Mar 2000 14:06:07 -0000 Received: (qmail 94311 invoked by uid 65534); 27 Mar 2000 14:06:07 -0000 Message-ID: <20000327140607.94310.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnpl6$73si@e...> Date: Mon, 27 Mar 2000 15:04:50 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0036_01BF97FD.CCE1E6A0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0036_01BF97FD.CCE1E6A0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > So there. *slaps you and runs away* [quivers slightly] Ooh. Again, again! *advances on you with a spiky baseball bat* [breathes in] Can you at least that I spotted a very real flaw (and missed another, Er, can I at least what? which my Proposal covers anyway), Proposed to fix it, abused it for amusement, decided that it maybe wasn't in the spirit of things to kill the game by the end of the second Week, and have taken steps to fix it, in a "don't hate me" stylee? Oh I don't hate you. But I'll reconsider mailmombing you. [collapses on the floor, hyperventilating] Hmm, I'm supposed to do something with a brown paper bag, I think. ------=_NextPart_000_0036_01BF97FD.CCE1E6A0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
 
> So there. *slaps you and runs away*
[quivers slightly] Ooh. = Again, again!
*advances on you with a spiky baseball bat*

[breathes in]
Can= you at = least that I spotted a very real flaw (and missed another,
 
Er, can I at least what?

which my Proposal co= vers = anyway), Proposed to fix it, abused it for
amusement, decided that it = maybe = wasn't in the spirit of things to kill
the game by the end of the seco= nd = Week, and have taken steps to fix it,
in a "don't hate me" stylee?
 
Oh I don't hate you. But I'll reconsider mailmombing = you.

[collapses on the fl= oor, = hyperventilating]
Hmm, I'm supposed to do something with a brown paper = bag, I = think.
------=_NextPart_000_0036_01BF97FD.CCE1E6A0-- From Mon Mar 27 06:10:12 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:10:30 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 9957 invoked from network); 27 Mar 2000 14:10:29 -0000 Received: from mw.egroups.com (10.1.2.2) by iqh.egroups.com with SMTP; 27 Mar 2000 14:10:29 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.6] by mw.egroups.com with NNFMP; 27 Mar 2000 14:10:29 -0000 Date: Mon, 27 Mar 2000 06:10:29 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnq4l$i4ed@e...> In-Reply-To: <8bnpl6$73si@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit Oh, and you don't have to refer to me as "The infeasibly large dairy product, in charge of all the paperclips" until /next/ Week. [Notices that because the wording has changed in Rule 6, his re-issue Proposal is now effect-less anyway] Oh, arse. Can we do some sort of surgery on Rule 6 to plug this, maybe using Justice? I'm fed up of wasting feckin' Proposals in mal-formed and abortive attempts to fix things that I screwed up in the first place. Especially since it now won't be plugged until Week 5, earliest. I think I'll Propose a policy on "Gentlemen's Agreements", too, so that new Players can't say, "well I didn't Agree to not abuse the gaping maw in Rule 6, so nyer. Nyer nyer!" This is on top of suggesting that we form a Gentlemen's Agreement on not abusing the flaw in Rule 6, of course. I'd like to suggest a Gentlemen's Agreement on not abusing the flaw in Rule 6. All in favour, say "Here! Here!". All not in favour, say "Rhubarb! Rhubarb!" --TheTwistedOne. From Mon Mar 27 06:12:38 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:12:56 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 22694 invoked from network); 27 Mar 2000 14:12:55 -0000 Received: from ck.egroups.com (10.1.2.83) by iqg.egroups.com with SMTP; 27 Mar 2000 14:12:55 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.119] by ck.egroups.com with NNFMP; 27 Mar 2000 14:12:54 -0000 Date: Mon, 27 Mar 2000 06:12:50 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnq92$avc9@e...> In-Reply-To: <20000327140607.94310.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Can you at least that I spotted a very real flaw (and missed another, > > Er, can I at least what? [grins] Bugger. Er, rather, I meant to type "agree" there, or something. --TheTwistedOne From Mon Mar 27 06:14:54 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:15:13 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 25396 invoked from network); 27 Mar 2000 14:15:08 -0000 Received: from ck.egroups.com (10.1.2.83) by iqg.egroups.com with SMTP; 27 Mar 2000 14:15:08 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.119] by ck.egroups.com with NNFMP; 27 Mar 2000 14:15:08 -0000 Date: Mon, 27 Mar 2000 06:14:59 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnqd3$avdc@e...> In-Reply-To: <8bnq92$avc9@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Oh I don't hate you. But I'll reconsider mailmombing you. [smiles] And I'll let "mailmombing" go, unless it turns out to be especially cruel. --TheTwistedOne From Mon Mar 27 06:16:45 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:17:03 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 16525 invoked from network); 27 Mar 2000 14:17:02 -0000 Received: from oe7.law7.hotmail.com (HELO hotmail.com) (216.33.236.111) by qh.egroups.com with SMTP; 27 Mar 2000 14:17:02 -0000 Received: (qmail 76857 invoked by uid 65534); 27 Mar 2000 14:17:02 -0000 Message-ID: <20000327141702.76856.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnq92$avc9@e...> Date: Mon, 27 Mar 2000 15:15:46 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_004F_01BF97FF.53B7C3B0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_004F_01BF97FF.53B7C3B0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Can you at least that I spotted a very real flaw (and missed another, > > Er, can I at least what? [grins] Bugger. Er, rather, I meant to type "agree" there, or something. No, that doesn't make any sense either: >Can you at least something that I spotted a very real flaw (and missed ano= ther, ------=_NextPart_000_004F_01BF97FF.53B7C3B0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
 
> Can you=
at least that I spotted a very real flaw (and missed
another,
>
> Er, can I at least what?
[grins] Bugger. Er, rather, I meant to type "agree" there, or something.

No, that doesn't make any sense either:
>Can you at least some=
thing that I spotted a very real flaw (and missed another,

 
------=_NextPart_000_004F_01BF97FF.53B7C3B0-- From Mon Mar 27 06:21:57 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:22:16 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 21480 invoked from network); 27 Mar 2000 14:22:10 -0000 Received: from mo.egroups.com (10.1.1.34) by iqh.egroups.com with SMTP; 27 Mar 2000 14:22:10 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.124] by mo.egroups.com with NNFMP; 27 Mar 2000 14:22:10 -0000 Date: Mon, 27 Mar 2000 06:22:06 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnqqe$d380@e...> In-Reply-To: <20000327141702.76856.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > No, that doesn't make any sense either: > >Can you at least something that I spotted a very real flaw (and missed another, There's a point at which I stop talking to people who are being awkward bastards. You've crossed it. --TheTwistedOne From Mon Mar 27 06:25:20 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:25:39 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 24559 invoked from network); 27 Mar 2000 14:25:24 -0000 Received: from oe51.law7.hotmail.com (HELO hotmail.com) (216.33.236.87) by qh.egroups.com with SMTP; 27 Mar 2000 14:25:24 -0000 Received: (qmail 61817 invoked by uid 65534); 27 Mar 2000 14:25:23 -0000 Message-ID: <20000327142523.61816.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnq4l$i4ed@e...> Date: Mon, 27 Mar 2000 15:19:35 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0058_01BF97FF.DC6A4570" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0058_01BF97FF.DC6A4570 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Oh, and you don't have to refer to me as "The infeasibly large dairy product, in charge of all the paperclips" until /next/ Week. [Notices that because the wording has changed in Rule 6, his re-issue Proposal is now effect-less anyway] Oh, arse. Actually I can call you anything I like.So there. :) Hmm. One of the rules says "Players must adhere to the rules", or similar= , but doesn't say what happens iif you don't. Can we do some sort of surgery on Rule 6 to plug this, maybe using Justice? I'm fed up of wasting feckin' Proposals in mal-formed and abortive attempts to fix things that I screwed up in the first place. It depends if the idea of Genomic is to go towards having fun, or finding= flaws in the English language...(which, and let us be honest here, is not = a difficult proposal) I'd like to suggest a Gentlemen's Agreement on not abusing the flaw in Rule 6. All in favour, say "Here! Here!". All not in favour, say "Rhubarb! Rhubarb!" *raises his hand and says "somewhere nearby" a couple of times* ------=_NextPart_000_0058_01BF97FF.DC6A4570 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Oh, and you don't have to refer to me as "The infeasibly large = dairy
product, in charge of all the paperclips" until /next/ Week.
=
[Notices that because the wording has changed in Rule= 6, his = re-issue
Proposal is now effect-less anyway] Oh, arse.
Actually I can call you anything I like.So there. = :)
Hmm. One of the rules says "Players must adhere to th= e = rules", or similar, but doesn't say what happens iif you don't.

Can we do some sort of surgery on Rule 6 t= o plug = this, maybe using
Justice? I'm fed up of wasting feckin' Proposals in = mal-formed and
abortive attempts to fix things that I screwed up in th= e = first place.

It depends if the idea of Genomic is to go towards ha= ving = fun, or finding flaws in the English language...(which, and let us be hon= est = here, is not a difficult proposal)

I'= d like = to suggest a Gentlemen's Agreement on not abusing the flaw in
Rule 6. = All = in favour, say "Here! Here!". All not in favour, say
"Rhubarb! = Rhubarb!"
*raises his hand = and says = "somewhere nearby" a couple of times*
------=_NextPart_000_0058_01BF97FF.DC6A4570-- From Mon Mar 27 06:27:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:27:31 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 5581 invoked from network); 27 Mar 2000 14:27:27 -0000 Received: from oe31.law7.hotmail.com (HELO hotmail.com) (216.33.236.26) by mx3.egroups.com with SMTP; 27 Mar 2000 14:27:27 -0000 Received: (qmail 52543 invoked by uid 65534); 27 Mar 2000 14:27:27 -0000 Message-ID: <20000327142727.52542.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnqd3$avdc@e...> Date: Mon, 27 Mar 2000 15:26:06 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_006C_01BF9800.C53E4E40" Content-Transfer-Encoding: 7bit ------=_NextPart_000_006C_01BF9800.C53E4E40 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Oh I don't hate you. But I'll reconsider mailmombing you. [smiles] And I'll let "mailmombing" go, unless it turns out to be especially cruel. Lol. bugger. Hold on *looks up 'mombing' on dictionary.com* Hmm mombin n 1: common tropical American shrub or small tree with purplish fr= uit Damn. Lol. What a surreal definition :) ------=_NextPart_000_006C_01BF9800.C53E4E40 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable

> Oh I don't hate you. But I'll reconsider mailmombing = you.
[smiles] And I'll let "mailmombing" go, unless it turns out to = be
especially cruel.
Lol. bugger. Hold on *looks up 'mombing' on = dictionary.com*
 
Hmm
 
mombin n 1: common t= ropical = American shrub or small tree with purplish fruit
 
Damn. Lol. What a surreal definition = :)
------=_NextPart_000_006C_01BF9800.C53E4E40-- From Mon Mar 27 06:27:10 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:27:28 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 26320 invoked from network); 27 Mar 2000 14:27:26 -0000 Received: from oe29.law7.hotmail.com (HELO hotmail.com) (216.33.236.249) by qh.egroups.com with SMTP; 27 Mar 2000 14:27:26 -0000 Received: (qmail 57855 invoked by uid 65534); 27 Mar 2000 14:27:26 -0000 Message-ID: <20000327142726.57854.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnqqe$d380@e...> Date: Mon, 27 Mar 2000 15:25:01 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0063_01BF9800.9E85BD10" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0063_01BF9800.9E85BD10 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > No, that doesn't make any sense either: > >Can you at least something that I spotted a very real flaw (and missed another, There's a point at which I stop talking to people who are being awkward bastards. You've crossed it. Sorry, that was actually a bad attempt at humour. :/ Does it help if I ad= d *grins* at the end? ------=_NextPart_000_0063_01BF9800.9E85BD10 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
> = No, that doesn't make any sense either:
> >Can you at least some= thing = that I spotted a very real flaw (and
missed another,

There's a point at which I stop talking to people who= are = being awkward
bastards. You've crossed it.

Sorry, that was actually a bad attempt at humour. :/ = Does it = help if I add *grins* at the end?
------=_NextPart_000_0063_01BF9800.9E85BD10-- From Mon Mar 27 06:38:34 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:38:53 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 4638 invoked from network); 27 Mar 2000 14:38:47 -0000 Received: from mr.egroups.com (10.1.1.37) by iqh.egroups.com with SMTP; 27 Mar 2000 14:38:47 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.15] by mr.egroups.com with NNFMP; 27 Mar 2000 14:38:47 -0000 Date: Mon, 27 Mar 2000 06:38:37 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnrpd$62j4@e...> In-Reply-To: <20000327142726.57854.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Sorry, that was actually a bad attempt at humour. :/ Does it help if I add *grins* at the end? Not really; s'just you've stumbled upon how to annoy the hell out of me. I'm all for pedantry ("Pedantry! Hurrah!" and such other shouts of adoration implied), but being argumentative for the sake of it winds me up no end. Still, calling you a "bastard", albeit with the "awkward" modifier (-4 offensive intent) and third-party context (-1 undirected attack) was a little harsh. And at least you didn't pick me up on my claiming that you'd 'crossed' a 'point'. [smiles] --TheTwistedOne (Erk. I used attack modifiers in a normal sentence). From Mon Mar 27 06:50:26 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:50:45 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 27468 invoked from network); 27 Mar 2000 14:50:41 -0000 Received: from mr.egroups.com (10.1.1.37) by iqg.egroups.com with SMTP; 27 Mar 2000 14:50:41 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.123] by mr.egroups.com with NNFMP; 27 Mar 2000 14:50:41 -0000 Date: Mon, 27 Mar 2000 06:50:36 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bnsfs$8jf7@e...> In-Reply-To: <8bnrpd$62j4@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Still, calling you a "bastard", albeit with the "awkward" modifier (-4 > offensive intent) and third-party context (-1 undirected attack) was a > little harsh. Damn. Meant to say sorry at the end there. Sorry, anway. Oh, and let's try and merge this into 1 thread, rather than the rapidly diverging two (or is it three now?) that we have going: >>[smiles] And I'll let "mailmombing" go, unless it turns out to be >>especially cruel. >Lol. bugger. Hold on *looks up 'mombing' on dictionary.com* >Hmm > mombin n 1: common tropical American shrub or small tree with purplish fruit >Damn. Lol. What a surreal definition :) Ah. Actually, feel free to mailmomb me then. They sound quite funky. Although they might get a bit mashed in transit. >It depends if the idea of Genomic is to go towards having fun, or finding >flaws in the English language... Genomic should be fun (I doubt I'd play it if it became otherwise), but not at the expense of accurate use of the language. We can't use the excuse that the language is flawed for mishaps in our use of it. That flaw is a little too large for my liking, because it was obvious to me, and others, as it turned out. >(which, and let us be honest here, is not a difficult proposal) [laughs] So very, very true. But it's not all that hard to make statements accurate. --TheTwistedOne From Graeme Jefferis Mon Mar 27 06:58:10 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 14:58:28 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 1960 invoked from network); 27 Mar 2000 14:58:25 -0000 Received: from grieg.dmu.ac.uk (HELO dmu.ac.uk) (146.227.1.5) by qg.egroups.com with SMTP; 27 Mar 2000 14:58:25 -0000 Received: from garozzo.cse.dmu.ac.uk (root@g... [146.227.102.42]) by dmu.ac.uk (8.10.0.Beta12/8.10.0.Beta12) with ESMTP id e2REuEv01565 for ; Mon, 27 Mar 2000 15:56:14 +0100 Received: from napier.cs.cse.dmu.ac.uk (se98gj@n... [146.227.102.73]) by garozzo.cse.dmu.ac.uk (8.9.3/8.9.3/g3.1b) with ESMTP id PAA12655 for ; Mon, 27 Mar 2000 15:58:13 +0100 (BST) From: Graeme Jefferis Received: (from se98gj@l...) by napier.cs.cse.dmu.ac.uk (8.9.3/8.9.3/c1.8) id PAA20504 for genomic@egroups.com; Mon, 27 Mar 2000 15:58:12 +0100 (BST) Date: Mon, 27 Mar 2000 15:58:12 +0100 (BST) Message-Id: <200003271458.PAA20504@n...> To: genomic@egroups.com Content-MD5: +3iBOI1M1TzzA71YJMVq4w== Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Inspecting the bestiary. MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Here we go. I doubt that I'm going to be evolving very far, but that's randomnity for you... DJ Arcas: Large, two armed, six legged, huge pointy toothed, human-eyed creature. Gallivanting Tripper: Large, four armed, two legged, toothed, near-blind creature. Grimace: Tiny, two armed, legless, beaked, near-blind creature. Kevan: Small, two armed, four legged, huge pointy toothed, hollow-eyed creature. Mac: Large, four armed, two legged, beaked, multi-facet-eyed, winged creature. Max Realism: Small, two armed, two legged, toothed, near-blind creature. microstoned: Huge, two armed, six legged, toothed, human-eyed creature. Oloros: Small, armless, six legged, beaked, hollow-eyed, winged creature. Pulp: Tiny, two armed, four legged, toothless, human-eyed, winged creature. Raven: Huge, two armed, legless, beaked, near-blind, winged creature. TopHeavy: Tiny, two armed, six legged, huge pointy toothed, eyed, winged creature. The Twisted One: Small, two armed, legless, toothed, hollow-eyed creature. Tyrethali: Huge, two armed, legless, huge pointy toothed, hollow-eyed creature. Xylen: Tiny, two armed, two legged, beaked, multi-facet-eyed creature. -Grimace. From Mon Mar 27 07:21:01 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 15:21:19 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 11442 invoked from network); 27 Mar 2000 15:21:17 -0000 Received: from mq.egroups.com (10.1.1.36) by iqh.egroups.com with SMTP; 27 Mar 2000 15:21:17 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.122] by mq.egroups.com with NNFMP; 27 Mar 2000 15:21:17 -0000 Date: Mon, 27 Mar 2000 07:21:08 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bnu94$6ghf@e...> In-Reply-To: <200003271458.PAA20504@n...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Inspecting the bestiary. MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Here we go. Amusing that Gallivanting Tripper is blind and top-heavy, and thus - indeed - quite likely to trip over whilst gallivanting. And Raven seems to have managed wings and a beak for himself. The rest of us seem to have decent enough phenotypes, anyway. Xylen seems quite endearing, and Tyrethali would seem to be the most fearsome of our number, judging by Proposal 037... It looks like this DNA business might be quite entertaining. > I doubt that I'm going to be evolving very far, but that's randomnity > for you... Not really; if you get eaten, one of your offspring might not have the genetic drawback that aided your demise. That's natural selection for you. (Although, no, hang on, I seem to have forgotten to include a "what happens when Eaten" thing in Proposal 037. Tsk. Well, you can always use 038 or 066, if either of those passes.) Kevan -- kevan@s... http://www.stormloader.com/kevan From Mon Mar 27 07:30:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 15:30:23 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 262 invoked from network); 27 Mar 2000 15:30:20 -0000 Received: from oe37.law7.hotmail.com (HELO hotmail.com) (216.33.236.32) by qg.egroups.com with SMTP; 27 Mar 2000 15:30:20 -0000 Received: (qmail 47413 invoked by uid 65534); 27 Mar 2000 15:30:19 -0000 Message-ID: <20000327153019.47412.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnrpd$62j4@e...> Date: Mon, 27 Mar 2000 16:27:15 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0086_01BF9809.5031ECC0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0086_01BF9809.5031ECC0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Sorry, that was actually a bad attempt at humour. :/ Does it help if I add *grins* at the end? Not really; s'just you've stumbled upon how to annoy the hell out of me. I'm all for pedantry ("Pedantry! Hurrah!" and such other shouts of adoration implied), = Then I'm in the right place *grins* >but being argumentative for the sake of it winds me up no end. Sorry. *fairly unrepentant look* Still, calling you a "bastard", albeit with the "awkward" modifier (-4 offensive intent) and third-party context (-1 undirected attack) was a little harsh. And at least you didn't pick me up on my claiming that you'd 'crossed' a 'point'. [smiles] Hoho, didn't I? Actually, I did, but I thought I might be pushing my luck ;= ) (Erk. I used attack modifiers in a normal sentence). Shame. Shame. *waves rolled up newspaper at you* ------=_NextPart_000_0086_01BF9809.5031ECC0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
> Sorry, that was actually a bad attempt at humour. :/=
Does it help
if I add *grins* at the end?

Not really; s'just you've stumbled upon how to annoy the hell out of
me. I'm all for pedantry ("Pedantry! Hurrah!" and such other shouts of
adoration implied), 
Then I'm in the right place *grins*
 
 
>but being argumentative for the sak=
e of it winds me
up no end.

Sorry. *fairly unrepentant look*
Still, calling you a "bastard", albeit with the "awkward" modifier (-4
offensive intent) and third-party context (-1 undirected attack) was a
little harsh.

And at least you didn't pick me up on my claiming that you'd 'crossed'
a 'point'. [smiles]

Hoho, didn't I? Actually, I did, but I thought I might be pushin=
g my luck ;)
(Erk. I used attack modifiers in a normal sentence).

Shame. Shame. *waves rolled up newspaper at you*
------=_NextPart_000_0086_01BF9809.5031ECC0-- From Mon Mar 27 07:30:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 15:30:24 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 18818 invoked from network); 27 Mar 2000 15:30:21 -0000 Received: from oe22.law7.hotmail.com (HELO hotmail.com) (216.33.236.242) by mx3.egroups.com with SMTP; 27 Mar 2000 15:30:21 -0000 Received: (qmail 78853 invoked by uid 65534); 27 Mar 2000 15:30:21 -0000 Message-ID: <20000327153021.78852.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnsfs$8jf7@e...> Date: Mon, 27 Mar 2000 16:28:37 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: The infeasibly large dairy product, in charge of all the paperclips MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_008F_01BF9809.80BC3990" Content-Transfer-Encoding: 7bit ------=_NextPart_000_008F_01BF9809.80BC3990 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable > Still, calling you a "bastard", albeit with the "awkward" modifier (-4 > offensive intent) and third-party context (-1 undirected attack) was a > little harsh. Damn. Meant to say sorry at the end there. Sorry, anway. Apology accepted (Captain Needa) >>[smiles] And I'll let "mailmombing" go, unless it turns out to be >>especially cruel. >Lol. bugger. Hold on *looks up 'mombing' on dictionary.com* >Hmm > mombin n 1: common tropical American shrub or small tree with purplish fruit >Damn. Lol. What a surreal definition :) Ah. Actually, feel free to mailmomb me then. They sound quite funky. Although they might get a bit mashed in transit. It doesn't mention if they're edible, and I've never seen them in Tesco's= ... >(which, and let us be honest here, is not a difficult proposal) [laughs] So very, very true. But it's not all that hard to make statements accurate. = Assuming you got some sleep! *false bright look* ------=_NextPart_000_008F_01BF9809.80BC3990 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
> Still, calling you a "bastard", albeit with the "awkward" modif= ier = (-4
> offensive intent) and third-party context (-1 undirected atta= ck) = was a
> little harsh.
Damn. Meant to say sorry at the end there.= = Sorry, anway.
Apology accepted (Captain Needa)

>>[smiles] And= I'll let = "mailmombing" go, unless it turns out to be
>>especially = cruel.
>Lol. bugger. Hold on *looks up 'mombing' on = dictionary.com*
>Hmm
> mombin n 1: common tropical American s= hrub = or small tree with
purplish fruit
>Damn. Lol. What a surreal = definition :)
Ah. Actually, feel free to mailmomb me then. They sound = quite = funky.
Although they might get a bit mashed in transit.
It doesn't mention if they're edible, and I've never = seen = them in Tesco's...</conclusion>


>(which, and let us be honest here, is not a = difficult proposal)
[laughs] So very, very true. But it's not all that= hard = to make
statements accurate.

Assuming = you got = some sleep! *false bright look*
------=_NextPart_000_008F_01BF9809.80BC3990-- From Mon Mar 27 07:40:36 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 15:40:54 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 9551 invoked from network); 27 Mar 2000 15:40:50 -0000 Received: from oe49.law7.hotmail.com (HELO hotmail.com) (216.33.236.85) by qg.egroups.com with SMTP; 27 Mar 2000 15:40:50 -0000 Received: (qmail 383 invoked by uid 65534); 27 Mar 2000 15:40:49 -0000 Message-ID: <20000327154049.382.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <200003271458.PAA20504@n...> Date: Mon, 27 Mar 2000 16:35:19 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Inspecting the bestiary. MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_00B0_01BF980A.7093E9E0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_00B0_01BF980A.7093E9E0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Woohoo! = Who's scared of me now? :) *gnashes his huge pointy teeth with a smug look on his face* DJ Arcas - Large, two armed, six legged, huge pointy toothed, human-eyed = creature. ------=_NextPart_000_00B0_01BF980A.7093E9E0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Woohoo!
 
Who's scared of me now? :)
 
*gnashes his huge pointy teeth with a smug look on his = face*
 
DJ = Arcas - Large, two armed, six legged, huge pointy toothed, human-eyed = creature.

------=_NextPart_000_00B0_01BF980A.7093E9E0-- From Mon Mar 27 07:40:37 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 15:40:55 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 25725 invoked from network); 27 Mar 2000 15:40:51 -0000 Received: from oe52.law7.hotmail.com (HELO hotmail.com) (216.33.236.88) by mx3.egroups.com with SMTP; 27 Mar 2000 15:40:51 -0000 Received: (qmail 13683 invoked by uid 65534); 27 Mar 2000 15:40:50 -0000 Message-ID: <20000327154050.13682.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bnu94$6ghf@e...> Date: Mon, 27 Mar 2000 16:37:07 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Inspecting the bestiary. MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_00C7_01BF980A.B0F73870" Content-Transfer-Encoding: 7bit ------=_NextPart_000_00C7_01BF980A.B0F73870 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable Amusing that Gallivanting Tripper is blind and top-heavy, and thus - indeed - quite likely to trip over whilst gallivanting. And Raven seems to have managed wings and a beak for himself. And Max Realism's is extremely accurate (I can say this in the happy know= ledge that he can't eat me, although no-one metioned laying traps yet :) (Although, no, hang on, I seem to have forgotten to include a "what happens when Eaten" thing in Proposal 037. Tsk. Well, you can always use 038 or 066, if either of those passes.) Well, for a start, you get digested... :-) ------=_NextPart_000_00C7_01BF980A.B0F73870 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
Amusing that Gallivanting Tripper is blind and top-heavy, and thus = -
indeed - quite likely to trip over whilst gallivanting. And Raven = seems
to have managed wings and a beak for himself.
And Max Realism's is extremely accurate (I can say th= is in = the happy knowledge that he can't eat me, although no-one metioned laying= = traps yet :)
 

(Although, no, hang on, I seem to have for= gotten = to include a "what
happens when Eaten" thing in Proposal 037. Tsk. Wel= l, = you can always
use 038 or 066, if either of those passes.)
Well, for a start, you get digested... = :-)
------=_NextPart_000_00C7_01BF980A.B0F73870-- From RavenBlack Mon Mar 27 10:00:22 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 18:00:40 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 29229 invoked from network); 27 Mar 2000 18:00:37 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by mx3.egroups.com with SMTP; 27 Mar 2000 18:00:37 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12Zdoa-0006l9-00 for genomic@egroups.com; Mon, 27 Mar 2000 13:00:37 -0500 Message-Id: <3.0.2.32.20000327130052.0307ea10@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 27 Mar 2000 13:00:52 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <200003271458.PAA20504@n...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Genomic Passwords MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit Since it doesn't state in the Rules that Players will get a username and password from the Speaker, I've decided to expedite matters by distributing such things myself. You should now have a username and password for voting at http://www.ravenblack.net/~genomic/ If you don't, you're probably one of Gallivanting Tripper (whose username is 'Tripper') Mac TopHeavy whose email addresses I couldn't easily acquire. (No doubt I could have acquired them if I felt like expending energy) If you are one of those three, or anyone else who hasn't received their username and password and is a Player, email me for it. --RavenBlack raven@r... ICQ 3105892 http://www.ravenblack.net/ Why do fools fall in love? So they can reproduce and outnumber us. From RavenBlack Mon Mar 27 10:39:00 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 18:39:19 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 24266 invoked from network); 27 Mar 2000 18:39:16 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by mx3.egroups.com with SMTP; 27 Mar 2000 18:39:16 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12ZePx-0003eS-00 for genomic@egroups.com; Mon, 27 Mar 2000 13:39:13 -0500 Message-Id: <3.0.2.32.20000327133931.0076b1bc@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 27 Mar 2000 13:39:31 -0500 To: genomic@egroups.com From: RavenBlack In-Reply-To: <200003271458.PAA20504@n...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Commentary upon this Week's crop MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit Incidentally, the output from the online Voting looks like this: FOR Proposal 037 - The Brutish Gene FOR Proposal 038 - What, the Curtains? AGAINST Proposal 039 - In Veto Veritas etc. And you can Vote over your given Votes if you change your mind before the Interregnum. I mention this so that anyone who feels like making one of these commentaries can do so without chopping their way through the message extracting only the titles of each Proposal. AGAINST Proposal 039 - In Veto Veritas Though the effect is fine, the cause is poor. The situation described will occur rarely. I prefer not to add 15 lines to the Rules for something that will almost never happen, and when it does, doesn't have a dramatic effect. (Rare dramatic effects or common small effects are good) I'm sure people will disagree with this, but it's my preference, and thus my Vote. FOR Proposal 042 - Exhaust Fumes Though I'd like to see this modified to protect anyone who could end up having to do an unfair amount of work. FOR Proposal 043 - Simple Constructs I like this as a simpler way of construing the favorability of Proposals. It will make later Proposals along the lines of the "50% PASS Votes fails" one much simpler to Propose, and with cleaner effects. It's easier to speak of a high Vote Score than to speak of "many more FOR Votes than AGAINST Votes". FOR Proposal 044 - Survival of the For-est Since we had that Proposal that completely erased the effects of other Passed Proposals in the same week... FOR Proposal 045 - Scaled Votes Note that this one does _not_ create too much work. Assuming Players are going to be Voting on the online form, at least. It's only a small modification for me to make the Perl thing include a range of Votes _if_ it's done this way. AGAINST Proposal 046 - No dot coms here If this were in effect at the start, I'd go for it, but having a mix of this and, referring to older Proposals, the linear numbering, would just be annoying. AGAINST Proposal 048 - 20,000 Leagues and other Horrors A fine effect, but I hate messages in all capitals. And it would confuse the difference between FOR and for. AGAINST Proposal 051 - Does somebody need a hug? (or, "I don't love you anymore") My laziness strikes again. I don't want to have to Vote upon more small irrelevant details. I don't care who gets a teddy bear. Besides, "All players may then cast one, for each..." is a nasty missing word. AGAINST Proposal 052 - Keeping abreast Seems an unnecessary Rule, since any information that needs to be distributed so will usually say so explicitly. The "same time" means the Speaker would have to put _all_ information into one mail. I prefer such things to be split up in an intuitive sort of way. Besides, some things are better kept just on the website, if they don't change a lot or don't effect anything. (Such as Statistics, at the moment) AGAINST Proposal 053 - The Espousal of Special Particulars Again, my dislike of extraneous data rejects this. Maybe I'm just being curmudgeonly. (Note, my 'Statistics' thing doesn't fall to this same problem because no more data is created, it's just collated differently) I also have the surreptitious objection to this, that it doesn't automate easily because the data set doesn't know who made each Proposal. PASS on Proposal 054 - Standing on the Shoulders of Giants, or All's Swell That Ends Swell Though I agree with the sentiment, I think such things should be Proposed as part of the Victory Condition. At the moment, after all, we don't even know that the game will restart if a Victory Condition is reached. My, I _am_ being curmudgeonly. PASS on Proposal 055 - Sign Here, Please If speaking of protocol and upsets, the point is better taken up as discussion on list than part of a Rule. I was AGAINST on this, but I see potential for interesting developments. AGAINST Proposal 056 - Abstemiousness Passing Regards This one, I'm afraid, is purely a "this would be awkward to implement in the automation" objection. AGAINST Proposal 057 - Groove is in the House I thought it seemed good for a moment, but then I reasoned thusly: Consider Proposal A with 5 Votes FOR and 6 PASS Votes. Consider Proposal B with 5 Votes FOR, 5 PASS, and 1 AGAINST. See the foolish anomaly? By changing your Vote from PASS to AGAINST you actually cause the Proposal to Pass. Hm. AGAINST Proposal 058 - I didn't do it, nobody saw me, and you can't prove anything! This would be a real pain to implement for the automated Voting. AGAINST Proposal 059 - Patches on the Fly I was about to Vote FOR this, since spelling corrections and such are good. Then I reasoned thusly: Consider My Proposal A: "Some spelling correction". By Sunday evening, this has 15 Votes FOR and 2 PASS Votes, say. Now, on Monday morning, at about 11am, I email the Speaker "I Modify the following Proposal: Some spelling correction - the body of the Proposal shall now read "RavenBlack is King of Everything and nobody else can do anything about it"." "Hm," says the Speaker, "That has changed the spirit of the Proposal. I shall dock him one Proposal for that week." However, nobody has time to change their Votes in light of the dramatic change to the Proposal, and so it passes. Foolish? I think so. Allowing Players to modify their Proposals before they are sent out, or make spelling / typo modifications would be fair though, if anyone fancies Proposing a sensible version of this. AGAINST Proposal 060 - For the Term of Its Natural Life What's Seniority? FOR Proposal 065 - Moooooooooo! Is there really a choice? Who wants Megalomaniacs to remain in the Ruleset? FOR Proposal 066 - Hopeful Monsters Purely for writing style. --RavenBlack raven@r... ICQ 3105892 http://www.ravenblack.net/ "Stormcrow cries, her tears fill the skies, And flood." From Mon Mar 27 13:16:46 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 21:17:04 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 9744 invoked from network); 27 Mar 2000 21:17:00 -0000 Received: from ef.egroups.com (10.1.2.111) by iqg.egroups.com with SMTP; 27 Mar 2000 21:17:00 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.124] by ef.egroups.com with NNFMP; 27 Mar 2000 21:17:00 -0000 Date: Mon, 27 Mar 2000 13:16:54 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8boj46$572i@e...> In-Reply-To: <3.0.2.32.20000327133931.0076b1bc@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Commentary upon this Week's crop MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit FOR Proposal 037 How could I /not/ Vote FOR this one? There's obviously a lot of work gone into it. PASS Proposal 040 I like the modification, but it undoes the Seniority modification. I'm slightly in favour of 040's effect, but I'll leave it up to everyone else. FOR Proposal 041 There's too little said about case 2 for my liking. I trust Kevan to be fair about "his discretion", but still. I'd be quite irate should Kevan (sorry, 'the Speaker') be in a rush, and forget to ask me if I'd done Voting and Proposing for the Week, whilst I was queueing a few things up. Currently, there's no chance for me to have the Week end delayed (if only that worked in RL, eh?). > FOR Proposal 042 - Exhaust Fumes > Though I'd like to see this modified to protect anyone > who could end up having to do an unfair amount of work. Agreed - FOR, with the same concerns. Perhaps a modification to > FOR Proposal 043 - Simple Constructs > I like this as a simpler way of construing the > favorability of Proposals. It will make later Proposals > along the lines of the "50% PASS Votes fails" one > much simpler to Propose, and with cleaner effects. > It's easier to speak of a high Vote Score than to speak > of "many more FOR Votes than AGAINST Votes". I agree. FOR. > FOR Proposal 044 - Survival of the For-est > Since we had that Proposal that completely erased > the effects of other Passed Proposals in the same > week... Eh? Did we? [shrugs] Missed that. Still, I like this one. FOR. > FOR Proposal 045 - Scaled Votes > Note that this one does _not_ create too much work. > Assuming Players are going to be Voting on the online > form, at least. It's only a small modification for me > to make the Perl thing include a range of Votes _if_ > it's done this way. MM and NAH are exactly equal to half a FOR or AGAINST? As in, casting a MM Vote reduces my pool by one-half of a Vote? This allows for more abuse currently, without the hole Adam S (or whatever his Player name is) spent the afternoon arguing about being plugged. [grins] AGAINST, currently. > AGAINST Proposal 046 - No dot coms here > If this were in effect at the start, I'd go for it, > but having a mix of this and, referring to older > Proposals, the linear numbering, would just be annoying. I'm more than happy saying "P001" to refer to Proposal 001, or "R006" when referring to Rule 006. It's more than adequate, and (more importantly, from my point of view) a no-brainer. AGAINST. AGAINST Proposal 047 I'd prefer it if it said "times are in GMT if not specified. Proposals specifying other time zones shall be returned-to-sender for resubmission with the correct GMT conversions done before Week's end." or something similar. > AGAINST Proposal 048 - 20,000 Leagues and other Horrors > A fine effect, but I hate messages in all capitals. > And it would confuse the difference between FOR and for. SHOUTING BLOWS. AGAINST. PASS Proposal 050 Foiled again [grins] (the wording of Rule 006 has changed, making this Proposal void, if it's not immediately obvious). I can't be bothered resubmitting this again. > AGAINST Proposal 051 - Does somebody need a hug? (or, > "I don't love you anymore") > My laziness strikes again. I don't want to have to > Vote upon more small irrelevant details. I don't care > who gets a teddy bear. Besides, "All players may then > cast one, for each..." is a nasty missing word. It sounds too much like hard work at this early point. AGAINST. > AGAINST Proposal 052 - Keeping abreast > Seems an unnecessary Rule, since any information that > needs to be distributed so will usually say so > explicitly. The "same time" means the Speaker would > have to put _all_ information into one mail. > I prefer such things to be split up in an > intuitive sort of way. Besides, some things are better > kept just on the website, if they don't change a lot > or don't effect anything. (Such as Statistics, at the > moment) The download times (both email and web-based) will rapidly spiral out-of-control, too. AGAINST. Perhaps a job for Raven and one of his funky CGI's, to extract and present relevant information should a Player request it? > AGAINST Proposal 053 - The Espousal of Special Particulars > Again, my dislike of extraneous data rejects this. Maybe > I'm just being curmudgeonly. For me, FOR. It sounds quite OK. Should the workload be heavy, Speaker-wise, we can always Vote to repeal it, eh? > I also have the surreptitious objection to this, that it > doesn't automate easily because the data set doesn't know > who made each Proposal. Tsk. "I'm going to Vote things down just because my CGI doesn't work for it properly." Hardly of worth, game-wise is it? One thing to watch for is that we don't build up too many attributes. We're starting to get to a point of overwhelming, from my point of view. Every Week new attributes, and other such (the Towers thing, for example) are being Proposed - and now Ruled. Currently, none of them really do anything but make work. I shan't be Voting FOR on too many more such things for a while. > PASS on Proposal 054 - Standing on the Shoulders of Giants, > or All's Swell That Ends Swell > Though I agree with the sentiment, I think such things > should be Proposed as part of the Victory Condition. > At the moment, after all, we don't even know that the > game will restart if a Victory Condition is reached. > My, I _am_ being curmudgeonly. AGAINST. Once "Victory Condition" is reached, there's a /lot/ of work. We can sort this out later. > PASS on Proposal 055 - Sign Here, Please > If speaking of protocol and upsets, the point is better > taken up as discussion on list than part of a Rule. > I was AGAINST on this, but I see potential for interesting > developments. FOR. I quite like the idea of perverting peoples' decisions by just pasting subtle incorrectness onto the end a message. Although a change to allow subsequent posting of a "Whoops, forgot my sig" apology to untrespass oneself would be good - the eGroups editor doesn't allow editing, or sigs, to my knowledge. On the side, I'm forgetful anyway. > AGAINST Proposal 056 - Abstemiousness Passing Regards > This one, I'm afraid, is purely a "this would be awkward > to implement in the automation" objection. Too many words with not enough satisfactory effect, and doesn't adequately plug My Pet Flaw. AGAINST. > AGAINST Proposal 057 - Groove is in the House > I thought it seemed good for a moment, but then I reasoned > thusly: > Consider Proposal A with 5 Votes FOR and 6 PASS Votes. > Consider Proposal B with 5 Votes FOR, 5 PASS, and 1 AGAINST. > See the foolish anomaly? By changing your Vote from PASS > to AGAINST you actually cause the Proposal to Pass. Hm. Er. Oh, yes. AGAINST. You think too much, man [grins]. > AGAINST Proposal 058 - I didn't do it, nobody saw me, and > you can't prove anything! > This would be a real pain to implement for the automated > Voting. So? I don't like the not getting a Proposal back bit, though. Only useful if the Proposal would reflect stupidity onto the Player proposing. PASS regardless, and see what everyone else thinks. > AGAINST Proposal 059 - Patches on the Fly [snipped commentary] Quite. AGAINST. > AGAINST Proposal 060 - For the Term of Its Natural Life > What's Seniority? I don't know, but Rule 006 was modified to include a condition based on it. I mustn't have been paying attention, either. I really don't like the idea of having to make a token modification to a Rule just to stop it being deleted. What if we all forget, or the modification has some unexpected flaw which makes it unpassable? AGAINST. PASS Proposal 061. I prefer this to Justice, but not for both to be in the Ruleset at the same time. I'm willing to go with the majority, though. AGAINST Proposal 063 Too wordy, takes no account of the Towers. AGAINST Proposal 064 Too dangerous, too insane. It'd destroy the Ruleset within Weeks. > FOR Proposal 065 - Moooooooooo! > Is there really a choice? Who wants Megalomaniacs to > remain in the Ruleset? Not me. The abuse was planned to make some sort of sub-game, along with pointing out the flaw, but the absurd power given by the Rule to me was, well, absurd. I thought I'd make the Rule be nonsense as punishment for me and it. FOR. > FOR Proposal 066 - Hopeful Monsters > Purely for writing style. [Assumes Homer voice, and drools slightly]Mmmmm. Heavily mutated. [Makes strangled gargling noise] FOR. --TheTwistedOne From RavenBlack Mon Mar 27 14:03:09 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 27 Mar 2000 22:03:28 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 18376 invoked from network); 27 Mar 2000 22:03:26 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 27 Mar 2000 22:03:26 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12ZhbZ-0005YD-00 for genomic@e...; Mon, 27 Mar 2000 17:03:25 -0500 Message-Id: <3.0.2.32.20000327165951.03739a0c@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 27 Mar 2000 16:59:51 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8boj46$572i@e...> References: <3.0.2.32.20000327133931.0076b1bc@w...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Commentary upon this Week's crop MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >MM and NAH are exactly equal to half a FOR or AGAINST? >As in, casting a MM Vote reduces my pool by one-half of >a Vote? This allows for more abuse currently, without the >hole Adam S (or whatever his Player name is) spent the >afternoon arguing about being plugged. [grins] No... MM and NAH are exactly equal to half a FOR or AGAINST _plus_ half a PASS. So you have cast a total of one Vote, half of which is FOR/AGAINST, half of which is PASS. You didn't read the Proposal, sir, you merely recalled what had been said of it in earlier conversation. --RavenBlack From Mon Mar 27 17:18:55 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 01:19:14 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 16225 invoked from network); 28 Mar 2000 01:18:56 -0000 Received: from fg.egroups.com (10.1.2.134) by iqh.egroups.com with SMTP; 28 Mar 2000 01:18:56 -0000 X-eGroups-Return: oloros@b... Received: from [10.1.2.127] by fg.egroups.com with NNFMP; 28 Mar 2000 01:18:56 -0000 Date: Mon, 27 Mar 2000 17:18:53 -0800 From: "Oloros" To: genomic@e... Message-ID: <8bp19t$tp12@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit /a tip of the hat to TheTwistedOne/ The passage of Megalomaniacs Anonymous puts us in a very interesting situation. While I may express no doubts that TheTwistedOne will prove to be a benevolent philospher king, and step down by invoking his proposal Moooooooo!, we must recognize that he did target Rule 8 for repeal last week as a part of his bid for authority . . . (With regards for Kevan, who got us all into this mess, but I would not have wanted to miss it for the fun it promises to become, ) I invoke JUSTICE on the following grounds: Rule 6 was plagued by such vargaries of English grammer and usage that it was unable to effectively administer the Voting on Proposals made during Week One, as there were at least three possible interpretations of of said Rule. Further, that said Rule was grossly abused by both assumptions that were practiced, Week One Voting should be declared null and void until explication on this Rule is made. There is no precedent for commentary upon such a message as this, and the Ruleset is quiet on the topic of whether or not matters under judgement should be discussed openly. Perhaps that shall be a second thread spawned by this posting. Pass the cheese whiz and the staples, Oloros From RavenBlack Mon Mar 27 17:47:05 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 01:47:24 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 3728 invoked from network); 28 Mar 2000 01:47:21 -0000 Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by qg.egroups.com with SMTP; 28 Mar 2000 01:47:21 -0000 Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12Zl6G-0005wB-00 for genomic@e...; Mon, 27 Mar 2000 20:47:20 -0500 Message-Id: <3.0.2.32.20000327204725.0373d760@w...> X-Sender: raven@w... X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32) Date: Mon, 27 Mar 2000 20:47:25 -0500 To: genomic@e... From: RavenBlack In-Reply-To: <8bp19t$tp12@e...> Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit >I invoke JUSTICE on the following grounds: >Rule 6 was plagued by such vargaries of English grammer and usage that >it was unable to effectively administer the Voting on Proposals made >during Week One, as there were at least three possible interpretations >of of said Rule. Further, that said Rule was grossly abused by both >assumptions that were practiced, Week One Voting should be declared >null and void until explication on this Rule is made. I don't believe that is an invocation of Justice, seeming to apply better to some of the Justice-alternatives that have been suggested. It doesn't look like an objection to the _legality_ of an action (which is the text of Rule 8), so much as an objection to the ethics or results of the action. Since I don't believe invoking Justice is legal in the context of questioning ethics, perhaps I should invoke Justice with regards to this invokation of Justice. But I can't be bothered. --RavenBlack From Mon Mar 27 20:01:21 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 04:01:40 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 29811 invoked from network); 28 Mar 2000 04:01:21 -0000 Received: from ef.egroups.com (10.1.2.111) by iqh.egroups.com with SMTP; 28 Mar 2000 04:01:21 -0000 X-eGroups-Return: flix_os@h... Received: from [10.1.2.5] by ef.egroups.com with NNFMP; 28 Mar 2000 04:01:05 -0000 Date: Mon, 27 Mar 2000 20:00:51 -0800 From: "Gallivanting Tripper" To: genomic@e... Message-ID: <8bpapj$nvaj@e...> In-Reply-To: <3.0.2.32.20000327204725.0373d760@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > >I invoke JUSTICE on the following grounds: > >Rule 6 was plagued by such vargaries of English grammer and usage that > >it was unable to effectively administer the Voting on Proposals made > >during Week One, as there were at least three possible interpretations > >of of said Rule. Further, that said Rule was grossly abused by both > >assumptions that were practiced, Week One Voting should be declared > >null and void until explication on this Rule is made. > > I don't believe that is an invocation of Justice, seeming > to apply better to some of the Justice-alternatives that > have been suggested. It doesn't look like an objection to > the _legality_ of an action (which is the text of Rule 8), > so much as an objection to the ethics or results of the > action. I think what Oloros meant was that the whole of Week 1 Voting was, perhaps, an illegal action - but this whole thing is just another example of how Genomic's "user-friendly" ruleset can get demolished by rule-lawyering. BTW, how do we know whether or not Kevan has appointed a Judge, how long the Judge has to give a Judgement or how we're going to find out about the result? (You might as well rewrite Rule 8 to say "There exist CFJs, so there") GT From Mon Mar 27 20:56:43 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 04:57:02 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 3941 invoked from network); 28 Mar 2000 04:57:00 -0000 Received: from f159.law8.hotmail.com (HELO hotmail.com) (216.33.241.159) by qg.egroups.com with SMTP; 28 Mar 2000 04:57:00 -0000 Received: (qmail 48470 invoked by uid 0); 28 Mar 2000 04:57:00 -0000 Message-ID: <20000328045700.48469.qmail@h...> Received: from 204.60.51.150 by www.hotmail.com with HTTP; Mon, 27 Mar 2000 20:57:00 PST X-Originating-IP: [204.60.51.150] From: "Tyrethali Ansrath" To: genomic@egroups.com Date: Mon, 27 Mar 2000 23:57:00 EST Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain; format=flowed Content-Transfer-Encoding: 7bit >...but this whole thing is just another >example of how Genomic's "user-friendly" ruleset can get demolished by >rule-lawyering. This is EXACTLY how I feel about the whole issue. You'd think, for once, there could be a Nomic where people followed the spirit of the rules instead of trying to exploit the exact wording. While I'm sure many a game can be played via the creative interpretation of key phrases here and there, and arguing about said interpretations, that's not exactly why I play nomic. Which is annoying, because sometimes it seems to be why most other people do. And, even if one is going strictly by the letter of the rules, it IS possible to fix a loop-hole without inserting a "I'm omnipotent, whoop-de-doo" rule just to show how it works. Even if you don't plan on exploiting that omnipotence. ~Tyrethali [Huge pointy-toothed player that will eat people if provoked, or hungry] ______________________________________________________ From Mon Mar 27 20:58:56 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 04:59:14 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8426 invoked from network); 28 Mar 2000 04:59:12 -0000 Received: from ck.egroups.com (10.1.2.83) by iqh.egroups.com with SMTP; 28 Mar 2000 04:59:12 -0000 X-eGroups-Return: flix_os@h... Received: from [10.1.2.128] by ck.egroups.com with NNFMP; 28 Mar 2000 04:59:12 -0000 Date: Mon, 27 Mar 2000 20:59:07 -0800 From: "Gallivanting Tripper" To: genomic@e... Message-ID: <8bpe6r$bgp2@e...> In-Reply-To: <3.0.2.32.20000327133931.0076b1bc@w...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Commentary upon this Week's crop MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > AGAINST Proposal 039 - In Veto Veritas > something that will almost never happen, > and when it does, doesn't have a dramatic effect. Really? Sounds like a reasonably proportioned prize for winning the tipping competition - although I rather like incentives to go against the voting flow - part of the original Suber idea, I think. Next week's Proposals . . . sigh > FOR Proposal 044 - Survival of the For-est > Since we had that Proposal that completely erased > the effects of other Passed Proposals in the same > week... this was the kind of thing the Retraction Proposal was meant to cope with (in a gentlemanly way, whereas this is brute force) > FOR Proposal 045 - Scaled Votes > Note that this one does _not_ create too much work. > Assuming Players are going to be Voting on the online > form, at least. It's only a small modification for me > to make the Perl thing include a range of Votes _if_ > it's done this way. Why bother with half a vote? If you don't really care, then PASS - on the other hand Oh well, why not?? > AGAINST Proposal 048 - 20,000 Leagues and other Horrors > A fine effect, but I hate messages in all capitals. > And it would confuse the difference between FOR and for. Indeed > AGAINST Proposal 051 - Does somebody need a hug? (or, > "I don't love you anymore") > My laziness strikes again. I don't want to have to > Vote upon more small irrelevant details. I don't care > who gets a teddy bear. Besides, "All players may then > cast one, for each..." is a nasty missing word. It seems like a bit too much of a fuss, and the original Teddy bear didn't even make it. > AGAINST Proposal 053 - The Espousal of Special Particulars > Again, my dislike of extraneous data rejects this. Maybe > I'm just being curmudgeonly. > (Note, my 'Statistics' thing doesn't fall to this same > problem because no more data is created, it's just > collated differently) > I also have the surreptitious objection to this, that it > doesn't automate easily because the data set doesn't know > who made each Proposal. My only objection - why wait two months before anyone becomes charming? > > AGAINST Proposal 056 - Abstemiousness Passing Regards > This one, I'm afraid, is purely a "this would be awkward > to implement in the automation" objection. ABSTAIN, PASS, STICK THIS VOTE UP YOUR *SS - what's the difference?? > AGAINST Proposal 057 - Groove is in the House > I thought it seemed good for a moment, but then I reasoned > thusly: > Consider Proposal A with 5 Votes FOR and 6 PASS Votes. > Consider Proposal B with 5 Votes FOR, 5 PASS, and 1 AGAINST. > See the foolish anomaly? By changing your Vote from PASS > to AGAINST you actually cause the Proposal to Pass. Hm. If a proposal makes too many people apathetic, it doesn't really deserve to get in, but I'd like to see the effect on voting patterns if this was enacted. > AGAINST Proposal 058 - I didn't do it, nobody saw me, and > you can't prove anything! > This would be a real pain to implement for the automated > Voting. See above > AGAINST Proposal 059 - Patches on the Fly > I was about to Vote FOR this, since spelling corrections > and such are good. Then I reasoned thusly: > Consider My Proposal A: "Some spelling correction". > By Sunday evening, this has 15 Votes FOR and 2 PASS Votes, say. > Now, on Monday morning, at about 11am, I email the Speaker > "I Modify the following Proposal: Some spelling correction > - the body of the Proposal shall now read "RavenBlack is > King of Everything and nobody else can do anything about > it"." > "Hm," says the Speaker, "That has changed the spirit of > the Proposal. I shall dock him one Proposal for that week." > However, nobody has time to change their Votes in light > of the dramatic change to the Proposal, and so it passes. > Foolish? I think so. You're no fun! Although I only noticed the loophole after I'd drafted the Proposal, I decided to leave it in to see who'd twig. Ah well, sprung. Shall I try for a more sensible version next Week? > Allowing Players to modify their Proposals before they > are sent out, or make spelling / typo modifications would > be fair though, if anyone fancies Proposing a sensible > version of this. > > AGAINST Proposal 060 - For the Term of Its Natural Life > What's Seniority? Something that a majority of voters thought was a good idea - a measure of how long you've been active in Genomic. This is another of my attempts to impose constant change on the ruleset - it's a bit less harmful than Mutate or Die last week, but I guess that won't sway you conservative buggers out there :-p > FOR Proposal 065 - Moooooooooo! > Is there really a choice? Who wants Megalomaniacs to > remain in the Ruleset? I'm not going to bother voting on this, if the megalomaniac wants out of the ruleset, he might as well do it himself! > FOR Proposal 066 - Hopeful Monsters > Purely for writing style. You mean, taking up two paragraphs of ruleset for a one-line effect - but that would just be being bitchy. GT sans signature, sans adjectifs > --RavenBlack raven@r... ICQ 3105892 > http://www.ravenblack.net/ > "Stormcrow cries, her tears fill the skies, > And flood." From Tue Mar 28 02:18:35 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 10:18:53 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 7313 invoked from network); 28 Mar 2000 10:18:52 -0000 Received: from oe52.law7.hotmail.com (HELO hotmail.com) (216.33.236.88) by qg.egroups.com with SMTP; 28 Mar 2000 10:18:52 -0000 Received: (qmail 79091 invoked by uid 65534); 28 Mar 2000 10:18:52 -0000 Message-ID: <20000328101852.79090.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bpe6r$bgp2@e...> Date: Tue, 28 Mar 2000 11:17:29 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Vaguely fun irrelevancy :) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0078_01BF98A7.348699A0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0078_01BF98A7.348699A0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable I hereby transfer 15 sludge from TheTwistedOne to RavenBlack. (no, no reaso= n, lol) I nominate Kevan as being responsible for me joining, and would like to be = linked to him on the Tree of Life ------=_NextPart_000_0078_01BF98A7.348699A0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
I hereby transfer 15 sludge from TheTwistedOne to Raven= Black. = (no, no reason, lol)
 
 
I nominate Kevan as being responsible for me joining, a= nd = would like to be linked to him on the Tree of Life
 
 
------=_NextPart_000_0078_01BF98A7.348699A0-- From Tue Mar 28 03:25:31 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 11:25:49 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 23128 invoked from network); 28 Mar 2000 10:55:39 -0000 Received: from c9.egroups.com (10.1.2.66) by iqh.egroups.com with SMTP; 28 Mar 2000 10:55:39 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.120] by c9.egroups.com with NNFMP; 28 Mar 2000 10:55:39 -0000 Date: Tue, 28 Mar 2000 02:55:31 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bq333$v837@e...> In-Reply-To: <20000328045700.48469.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > And, even if one is going strictly by the letter of the rules, it IS > possible to fix a loop-hole without inserting a "I'm omnipotent, > whoop-de-doo" rule just to show how it works. Even if you don't plan on > exploiting that omnipotence. Actually, P004 would have come before P001, had I thought to do so. I spotted the flaw Proposed to fix it, then decided to exploit it. Had I not made P004 so completely overwhelmingly restrictive, there would have been possibilities for a fun little excursion. But I did, and so have Proposed to remove it. I believe I said (essentially) this elsewhere, but it seems I have to repeat myself. So, once more, and hopefully this will make it clear: "I f'ked up, I apologise, can we /please/ move along and get on with the game now?" --TheTwistedOne From Tue Mar 28 03:34:19 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 11:34:38 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 4015 invoked from network); 28 Mar 2000 11:30:55 -0000 Received: from oe24.law7.hotmail.com (HELO hotmail.com) (216.33.236.244) by mx3.egroups.com with SMTP; 28 Mar 2000 11:30:55 -0000 Received: (qmail 59570 invoked by uid 65534); 28 Mar 2000 11:30:55 -0000 Message-ID: <20000328113055.59569.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bq333$v837@e...> Date: Tue, 28 Mar 2000 12:29:35 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0010_01BF98B1.4691B210" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0010_01BF98B1.4691B210 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable "I f'ked up, I apologise, can we /please/ move along and get on with the game now?" That's why I took 15 sludge from you, bwuahahahahah!!!! :) I'll get me coat... ------=_NextPart_000_0010_01BF98B1.4691B210 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable

"I f'ked up, I apologise, can we /please/ = move = along and get on with
the game now?"
That's why I took 15 sludge from you, bwuahahahahah!!= !! = :)
 
 
I'll get me coat...
------=_NextPart_000_0010_01BF98B1.4691B210-- From Tue Mar 28 03:43:21 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 11:43:40 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 14979 invoked from network); 28 Mar 2000 11:43:38 -0000 Received: from b05.egroups.com (10.1.2.184) by iqh.egroups.com with SMTP; 28 Mar 2000 11:43:38 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.15] by b05.egroups.com with NNFMP; 28 Mar 2000 11:43:35 -0000 Date: Tue, 28 Mar 2000 03:43:27 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bq5sv$5oe8@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] It's a... boy? MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit A new Player, "Grendel", has joined our ranks - The Twisted One and microstoned were randomly selected as parents, and the resultant DNA String turns out to be "CGTCGTCGGAGGTACTACTTCAC" (huge, two arms, six legs, toothed mouth and hollow eyes). Congratulations. I'll put a proper list of Player's DNA on the Web page as soon as I get my act together, and *should* find time to upload the "Tower of Law" page I scrawled offline last night. Keep an eye (or light-sensitive cell) out. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 28 03:48:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 11:48:32 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 21257 invoked from network); 28 Mar 2000 11:48:01 -0000 Received: from imk.egroups.com (HELO mk.egroups.com) (10.1.1.30) by iqg.egroups.com with SMTP; 28 Mar 2000 11:48:01 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.129] by mk.egroups.com with NNFMP; 28 Mar 2000 11:48:00 -0000 Date: Tue, 28 Mar 2000 03:47:52 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bq658$5t2g@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Tower of Law MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit http://www.crosswinds.net/~genomic/tower.html Windows start opened or closed at random, in the absence of any specific statement from the Proposal that enacted the Tower. Creatures without legs are advised to use the lift. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 28 04:10:57 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 12:11:15 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 4934 invoked from network); 28 Mar 2000 12:11:13 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqg.egroups.com with SMTP; 28 Mar 2000 12:11:13 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.24] by mv.egroups.com with NNFMP; 28 Mar 2000 12:11:11 -0000 Date: Tue, 28 Mar 2000 04:11:09 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bq7gt$8v2a@e...> In-Reply-To: <8bp19t$tp12@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > I invoke JUSTICE on the following grounds: > Rule 6 was plagued by such vargaries of English grammer and usage that > it was unable to effectively administer the Voting on Proposals made > during Week One, as there were at least three possible interpretations > of of said Rule. Further, that said Rule was grossly abused by both > assumptions that were practiced, Week One Voting should be declared > null and void until explication on this Rule is made. As worded, I think I'm going to have to reject this, since it doesn't specifically argue the legality of a Rule, it only voices concern with ambiguity and rule abuse. Justice calls really have to be along the lines of "I say Player X has broken Rule Y because Z"; you just seem to be saying "Player X has abused Rule Y", and we don't (yet) have a rule saying that unexpected loophole usage is illegal. Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 28 04:30:12 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 12:30:31 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 20465 invoked from network); 28 Mar 2000 12:30:29 -0000 Received: from ml.egroups.com (10.1.1.31) by iqg.egroups.com with SMTP; 28 Mar 2000 12:30:29 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.15] by ml.egroups.com with NNFMP; 28 Mar 2000 12:30:29 -0000 Date: Tue, 28 Mar 2000 04:30:23 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bq8kv$5pd2@e...> In-Reply-To: <20000328045700.48469.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: JUSTICE is best served cold MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > And, even if one is going strictly by the letter of the rules, it IS > possible to fix a loop-hole without inserting a "I'm omnipotent, > whoop-de-doo" rule just to show how it works. Even if you don't plan on > exploiting that omnipotence. I had replied to this with a calm rebuttal/explanation/apology, but the bastard eGroups system chose that moment to crash. It hasn't arrived since I posted something like 2 hours ago, so I'm assuming tis lost. Basically, P004 wasn't there to prove P001's purpose. It was there as an attempt to provide something interesting, after proposing to plug the flaw. Such a ploy failed, due to it giving me such power. So I have put Moooooo! in (whatever Proposal number it may be) to remove that power. Sorry, yadda yadda. --TheTwistedOne. From Tue Mar 28 04:39:03 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 12:39:22 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 18899 invoked from network); 28 Mar 2000 12:39:20 -0000 Received: from ck.egroups.com (10.1.2.83) by iqh.egroups.com with SMTP; 28 Mar 2000 12:39:20 -0000 X-eGroups-Return: genomic@t... Received: from [10.1.2.131] by ck.egroups.com with NNFMP; 28 Mar 2000 12:39:20 -0000 Date: Tue, 28 Mar 2000 04:39:12 -0800 From: "TheTwistedOne" To: genomic@e... Message-ID: <8bq95g$mhb4@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] eGroups web interface MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit [Checks his home email account using telnet]Oh, I see, it's just the web interface that's being entirely crap, is it? [Edits egroups out of his browser history]The bastards.[Considers the prospect of using Telnet to read what people post] --TheTwistedOne From Tue Mar 28 05:01:14 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 13:01:33 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 3428 invoked from network); 28 Mar 2000 13:01:19 -0000 Received: from c9.egroups.com (10.1.2.66) by iqh.egroups.com with SMTP; 28 Mar 2000 13:01:19 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.131] by c9.egroups.com with NNFMP; 28 Mar 2000 13:01:19 -0000 Date: Tue, 28 Mar 2000 05:01:11 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bqaen$ggnn@e...> In-Reply-To: <20000328101852.79090.qmail@h...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Vaguely fun irrelevancy :) MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > I hereby transfer 15 sludge from TheTwistedOne to RavenBlack. (no, no reason, lol) Not possible, I'm afraid, since Sludge must be transferred "in the amount of one unit per transfer", and - most critically - "Each Player may make only one sludge transfer per turn." Since there's no such thing as a Turn, nobody can make any transfers. I must confess I didn't realise the (presumably intentional?) properties of Sludge when I voted on it, actually. If anything it seems rather more interesting in light of this... Kevan -- kevan@s... http://www.stormloader.com/kevan From Tue Mar 28 05:08:52 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 13:09:11 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 27418 invoked from network); 28 Mar 2000 13:09:10 -0000 Received: from oe18.law7.hotmail.com (HELO hotmail.com) (216.33.236.122) by mx3.egroups.com with SMTP; 28 Mar 2000 13:09:10 -0000 Received: (qmail 82227 invoked by uid 65534); 28 Mar 2000 13:09:09 -0000 Message-ID: <20000328130909.82226.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <8bqaen$ggnn@e...> Date: Tue, 28 Mar 2000 14:06:00 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Vaguely fun irrelevancy :) MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0022_01BF98BE.BEE7E560" Content-Transfer-Encoding: 7bit ------=_NextPart_000_0022_01BF98BE.BEE7E560 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable *note to self* - don't speedread rules.*end note* ----- Original Message ----- = From: Kevan Davis = To: genomic@e... = Sent: Tuesday, March 28, 2000 2:01 PM Subject: [genomic] Re: Vaguely fun irrelevancy :) > I hereby transfer 15 sludge from TheTwistedOne to RavenBlack. (no, no reason, lol) Not possible, I'm afraid, since Sludge must be transferred "in the amount of one unit per transfer", and - most critically - "Each Player may make only one sludge transfer per turn." Since there's no such thing as a Turn, nobody can make any transfers. I must confess I didn't realise the (presumably intentional?) properties of Sludge when I voted on it, actually. If anything it seems rather more interesting in light of this... Kevan -- kevan@s... http://www.stormloader.com/kevan ---------------------------------------------------------------------------= --- To Post a message, send it to: genomic@e... To Unsubscribe, send a blank message to: genomic-unsubscribe@e... ---------------------------------------------------------------------------= --- eGroups.com Home: http://www.egroups.com/group/genomic www.egroups.com - Simplifying group communications ------=_NextPart_000_0022_01BF98BE.BEE7E560 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
*note to self* - don't speedread rules.*end note*
 
 
----- Original Message -----
Sent: Tuesday, March 28, 2000 2:01= = PM
Subject: [genomic] Re: Vaguely fun= = irrelevancy :)

> I hereby transfer 15 sludge from TheTwistedOne to = RavenBlack. (no, no
reason, lol)

Not possible, I'm afraid, sinc= e = Sludge must be transferred "in the
amount of one unit per transfer", a= nd - = most critically - "Each Player
may make only one sludge transfer per t= urn." = Since there's no such
thing as a Turn, nobody can make any = transfers.

I must confess I didn't realise the (presumably = intentional?)
properties of Sludge when I voted on it, actually. If = anything it seems
rather more interesting in light of = this...

Kevan

--
kevan@s...=
http://www.stormloader.com/keva= n

To Post a message, send it to: genomic@e...
To Unsubscribe, send a blank message to: genomic-unsubscribe@e...
3D""
eGroups.com= Home: = http://www.egroups.com/grou= p/genomic
www.egroups.com - Simplifying group = communications
------=_NextPart_000_0022_01BF98BE.BEE7E560-- From Graeme Jefferis Tue Mar 28 06:18:59 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 14:19:18 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 31577 invoked from network); 28 Mar 2000 14:19:13 -0000 Received: from grieg.dmu.ac.uk (HELO dmu.ac.uk) (146.227.1.5) by qh.egroups.com with SMTP; 28 Mar 2000 14:19:13 -0000 Received: from garozzo.cse.dmu.ac.uk (root@g... [146.227.102.42]) by dmu.ac.uk (8.10.0.Beta12/8.10.0.Beta12) with ESMTP id e2SEH8v28969 for ; Tue, 28 Mar 2000 15:17:08 +0100 Received: from curlew.cs.cse.dmu.ac.uk (se98gj@c... [146.227.102.25]) by garozzo.cse.dmu.ac.uk (8.9.3/8.9.3/g3.1b) with ESMTP id PAA11729 for ; Tue, 28 Mar 2000 15:19:10 +0100 (BST) From: Graeme Jefferis Received: (from se98gj@l...) by curlew.cs.cse.dmu.ac.uk (8.9.3/8.9.3/c1.8) id PAA17058 for genomic@egroups.com; Tue, 28 Mar 2000 15:19:08 +0100 (BST) Date: Tue, 28 Mar 2000 15:19:08 +0100 (BST) Message-Id: <200003281419.PAA17058@c...> To: genomic@egroups.com Content-MD5: Ck4kT55znPD6ho21zPa+ig== Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Further proposal commentary MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Proposal 037 - The Brutish Gene This will do for now, I think. I like the gene dependencies introduced here, although it makes working out your vital statistics slightly more difficult. A : Player is Slightly Hairy. 'Fluffy' would be a more appealing term, but that's just me being arbitrary. The eating stuff is excellent; lots of fun. Proposal 038 - What, the Curtains? Hmm. Not a bad thing, in itself, but I think more interesting mutation handling could be added later. Proposal 039 - In Veto Veritas Quite interesting. Proposal 040 - I've come over all aquiver Iffy. There's floating usage of 'discarded' in there, to be appallingly pedantic; but even without it, I don't think the net effect is very special. Proposal 041 - Week Lemon Drink Mm, a little bit wordy and convoluted for my tastes: I simply don't think it has a significant effect, nor a beneficial one. Proposal 042 - Exhaust Fumes Alright, but if VETO passes, this can be more neatly acheived. Proposal 048 - 20,000 Leagues and other Horrors 037 proposes a Hands gene, so this becomes hard to advocate. Proposal 051 - Does somebody need a hug? Urgh.. has the effect of either amending last week's proposal, or creating a new proposal for next week. That said, the intended effect is perfectly clear... and the effect of /any/ modification to the ruleset is really based on the grounds of perceived intended effect; no matter how well specified the change. I could now launch into a poorly-thought-out exploration of the compromise between Nomic played-to-the-letter and played- by-common-sense, but I'll leave it for another time. Proposal 053 - The Espousal of Special Particulars Nothing against it, except it's a bit boring. It would get a 'nah' from me were I able to cast such a vote. Proposal 058 - I didn't do it, nobody saw me...! Actually, I quite like this. Proposal 064 - Ludicrous, dangerous insanity. This too. Ludicrous and insane indeed, but quite good fun... Proposal 066 - Hopeful Monsters Ah, irresistable. Proposal 067 - A Brief Mystery of Time Looks sensible. -Grimace. Not /intentionally/ terse this week... From Tue Mar 28 06:27:13 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 14:27:31 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 15301 invoked from network); 28 Mar 2000 14:27:25 -0000 Received: from oe9.law7.hotmail.com (HELO hotmail.com) (216.33.236.113) by mx3.egroups.com with SMTP; 28 Mar 2000 14:27:25 -0000 Received: (qmail 44995 invoked by uid 65534); 28 Mar 2000 14:27:25 -0000 Message-ID: <20000328142725.44994.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: <200003281419.PAA17058@c...> Date: Tue, 28 Mar 2000 15:26:04 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further proposal commentary MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_000C_01BF98C9.EE919530" Content-Transfer-Encoding: 7bit ------=_NextPart_000_000C_01BF98C9.EE919530 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable >Proposal 051 - Does somebody need a hug? >Urgh.. has the effect of either amending last week's proposal, >or creating a new proposal for next week. That was saves waiting until you see if a proposal has passed to amend it -= = this seemed like the quickest way at the time (if it passed, amend it, if i= t = didn't pass, then improve it and try again) >That said, the intended effect is perfectly clear... and the >effect of /any/ modification to the ruleset is really based >on the grounds of perceived intended effect; no matter how >well specified the change. Or how badly specified :p >I could now launch into a poorly-thought-out exploration of >the compromise between Nomic played-to-the-letter and played- >by-common-sense, but I'll leave it for another time. Do we have any common sense on the list, tho? :) ------=_NextPart_000_000C_01BF98C9.EE919530 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable 
>Proposal 051 - Does somebody need a hug?

>Urgh.. has the effect of either amending last week's proposal,
>or creating a new proposal for next week.
That was saves wait=
ing until you see if a proposal has passed to amend it - 
this se=
emed like the quickest way at the time (if it passed, amend it, if it 
didn't pass, then improve it and try again)
 

>That said, the intended effect is perfectly clear... and the
>effect of /any/ modification to the ruleset is really based
>on the grounds of perceived intended effect; no matter how
>well specified the change.

Or how badly specified :p
>I could now launch into a poorly-thought-out exploration of
>the compromise between Nomic played-to-the-letter and played-
>by-common-sense, but I'll leave it for another time.

Do we have any common sense on the list, tho? :)
 ------=_NextPart_000_000C_01BF98C9.EE919530-- From Tue Mar 28 06:29:06 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 14:29:24 -0000 Delivered-To: listsaver-egroups-genomic@e... Received: (qmail 8841 invoked from network); 28 Mar 2000 14:29:16 -0000 Received: from imv.egroups.com (HELO mv.egroups.com) (10.1.1.41) by iqh.egroups.com with SMTP; 28 Mar 2000 14:29:16 -0000 X-eGroups-Return: kevan@s... Received: from [10.1.2.123] by mv.egroups.com with NNFMP; 28 Mar 2000 14:29:15 -0000 Date: Tue, 28 Mar 2000 06:29:10 -0800 From: "Kevan Davis" To: genomic@e... Message-ID: <8bqfjm$qaa@e...> In-Reply-To: <8bnl92$dahu@e...> User-Agent: eGroups-EW/0.82 X-Mailer: eGroups Message Poster Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Week Three Proposals MIME-Version: 1.0 Content-Type: text/plain Content-Transfer-Encoding: 7bit > Proposal 037 - The Brutish Gene Careless of me to miss out the effects of being Eaten, but this doesn't stop the rules working, and can be fixed next Week, if needs be. > Proposal 039 - In Veto Veritas Raven said this seemed to rare to bother with, and I think he's probably right, at least judging by last Week's voting results. I'm used to Nomics with few more than a dozen Proposals per week, I suppose. > Proposal 040 - I've come over all aquiver This mercilessly overwrites stuff that Proposal 039 tries to do and also removes the Seniority thing which was added recently; "reword entire Rule" proposals are *bad*, unless you really are overhauling the whole thing. This seems just to add a "automatically repropose ties" clause, which is fair enough, but I can't vote for it when it damages other things. > Proposal 041 - Week Lemon Drink A good idea, but harshly implemented; as it's written, I can cheerfully look up and say "Right, the Week's over" on any given Thursday, if I've had enough Proposals - anyone yet to Propose or Vote is ignored. This would lead to everyone rushing to get their stuff in for the next very-short deadline - you might as well just propose a three/four day week and be done with it, really, to see if it's what people want. Personally I think seven days is about right, giving enough room for discussion, contemplation, Speaker ineptitude, and whatever subgame malarkey might be going on. > Proposal 042 - Exhaust Fumes Good. > Proposal 043 - Simple Constructs Neat, but I'm not really sure how much we'll want to use these. > Proposal 044 - Survival of the For-est Vaguely annoying from a Speaker perspective (I prefer to be able to just grind my way through the Proposals, when enacting them, rather than checking them all against each other first). Hm. > Proposal 045 - Scaled Votes I'm not sure I'm ever that torn about a Proposal - either it's good, it's bad or I don't care either way (or lack the time to give the thing a fair analysis and feel happy to leave it to other people). I can't imagine using the half-way votes. > Proposal 046 - No dot coms here This doesn't seem to make anything easier, to be honest. > Proposal 048 - 20,000 Leagues and other Horrors Tres amusing, but annoying after five minutes, sadly. > Proposal 049 - Donald Trump Real Estate The numbering seems counter-intuitive, and we *still* haven't got rules to keep track of Player locations within the Tower. > Proposal 050 - Your Vote can make a difference, should TheTwistedOne > allow it! Good. > Proposal 051 - Does somebody need a hug? (or, "I don't love you > anymore") Fun, but I fear some new Players would be scared by the sudden limelight. And the Bear didn't get in last Week for, we presume, good reasons. > Proposal 052 - Keeping abreast > > Any attributes or statistics of, or items owned by a player, will be > submitted to the list by the speaker at the same time as the new > proposals Better left to discretion, I think. We don't necessarily need everything posted to the list, every Week, do we? Some things (the Tower windows, phenotypes) will change mid-Week, and be logged on the Web page; an end-of-week summary might be more trouble than it's worth, if people are keeping an eye on stuff anyway. > Proposal 053 - The Espousal of Special Particulars Minimal reward for a very slow process, and it's yet more annoying paperwork for me in the Interregnum. Bah. > Proposal 054 - Standing on the Shoulders of Giants, or All's Swell > That Ends Swell Eye-glazing stuff for the Voters, having to vote on every single Rule, and chances are most of the dull ones will have been repealed during the game anyway. This also goes on about "eras" (marked by the game being reset to default values, I presume), but doesn't bother defining them, which seems a shame. > Proposal 055 - Sign Here, Please Good that Players are encouraged to keep track of stuff, but very bad that it's required (albeit fairly unpunished) to be posted with every single mailing list message. I tend to do things from three or four different machines, and won't always have my exhaustive Player details with me. I do quite like the posting of phenotype after people's names, though, on the mailing list - it gives a nice picture of who we all are, game-wise. > Proposal 056 - Abstemiousness Passing Regards This does, it should be noted, bring back the loophole that 050 fixes. > Proposal 057 - Groove is in the House > > The Vote on a Proposal shall not be considered valid if more that > 50% of > Players cast a Vote of "PASS". A good intention, but I think if a dodgy Proposal gets through because too many people were indecisive about it, it's the price they pay for indecision. Possibly we need a "if more than 80% of Players failed to vote" thing, to catch any stupidity in quiet weeks, but I think we'll be alright. > Proposal 058 - I didn't do it, nobody saw me, and you can't prove > anything! This would be really annoying; I've been in Nomics that have such a feature, and it just means that Players wait to see general reactions to their Proposals, then quickly retract any that are likely to fail, thus avoiding any penalties they might incur for submitting bad Proposals. Good for letting Players take back genuinely damaging Proposals that weren't intended as such, of course, but I imagine that'd be better implemented as "If a Player votes AGAINST one of eir own Proposals, it fails." > Proposal 059 - Patches on the Fly Even if this were made more secure (that, say, the Speaker could actually reject spirit-changing tweaks), it'd still make voting unfair, since some people may well vote on the initial draft of the Proposal, lacking the time or Internet access to cast a new vote when it's been rewritten. > Proposal 060 - For the Term of Its Natural Life Very interesting, but also very fiddly for your dear Speaker (at least until he gets his act together and automates more of his duties). > Proposal 061 - Bring out the GIMP This is *excellent*, and I thoroughly approve of it. But, tragically, the GIMP won't actually have any powers, because curly braces only signify comments in *Proposals*. And "Silencing" a Rule is sadly undefined. Worth voting in and fixing next Week, though, I think. > Proposal 064 - Ludicrous, dangerous insanity. This seems like it could be very entertaining, but I don't know if I'm brave enough to vote in favour of it... Kevan -- kevan@s... http://www.stormloader.com/kevan From Pulp Tue Mar 28 06:45:02 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 14:45:21 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 2307 invoked from network); 28 Mar 2000 14:44:55 -0000 Received: from smtp.wpi.edu (130.215.24.62) by qg.egroups.com with SMTP; 28 Mar 2000 14:44:55 -0000 Received: from wpi.WPI.EDU (root@w... [130.215.24.6]) by smtp.WPI.EDU (8.10.1.Beta1/8.10.1.Beta1) with ESMTP id e2SEirh22650 for ; Tue, 28 Mar 2000 09:44:53 -0500 (EST) Received: from localhost (pulp@l... [127.0.0.1]) by wpi.WPI.EDU (8.10.1.Beta1/8.10.1.Beta1) with ESMTP id e2SEiqt19774 for ; Tue, 28 Mar 2000 09:44:52 -0500 (EST) Date: Tue, 28 Mar 2000 09:44:52 -0500 (EST) From: Pulp To: genomic@egroups.com In-Reply-To: <20000328142725.44994.qmail@h...> Message-ID: Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further proposal commentary MIME-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit > Do we have any common sense on the list, tho? :) I would venture to say yes, well into the plural even. However, science is the right way, so we'll take a poll: ******************************************************************* COMMON SENSES ON THE LIST (OR AMONG THOSE ON THE LIST, RATHER [OR CONTRIBUTING TO THE LIST, RATHER {AS WELL AS, COME TO THINK OF IT, THOSE NOT CONTRIBUTING, AS OF YET, BUT STILL INVOLVED IMPLICITLY BY HAVING JOINED THE GAME}]). {check all that apply} I have the capactity to: [ ] See; [ ] Hear; [ ] Smell; [ ] Taste; [ ] Feel, in the sense of tactile stimulation; [ ] Feel, in the sense of getting teary when the old hound dog in "Lady and the Tramp" gets hit by that damned car and you think maybe he won't make it, but it's a Disney flick so of course he does; [ ] Really, though, aren't "Smell" and "Taste" practically the same thing? I mean, yes, yes, you taste with your tongue and smell with your nose (or I do, anyhow), but without one the other is something between pointless and nonexistant. Arg, I do hope I'm not getting a cold; [ ] Poor taste in lovers; [ ] 75 cents American, enough to buy me a Pepsi; [ ] ESP. ******************************************************************* Results will be tabulated and filed permenently by the NSA. And yes, they keep an eye on Brits, too. Especially those who play Nomic. The FBI is involved too. Special Agent Pulp, Ph.D., M.D., OBGYN, STOP SEND MONEY STOP Joshua Millard == pulp@w... && www.wpi.edu/~pulp .-'-. '-.-' .-'-. '-.-' Yo' momma's .sig is so big, she's got to use a full screen editor just to, um, edit it. Yeah. From Tue Mar 28 06:55:39 2000 Delivered-To: listsaver-of-genomic@egroups.com Received: (listserv 315); by a2; 28 Mar 2000 14:55:57 -0000 Delivered-To: listsaver-egroups-genomic@egroups.com Received: (qmail 13274 invoked from network); 28 Mar 2000 14:55:55 -0000 Received: from oe23.law7.hotmail.com (HELO hotmail.com) (216.33.236.243) by qg.egroups.com with SMTP; 28 Mar 2000 14:55:55 -0000 Received: (qmail 60882 invoked by uid 65534); 28 Mar 2000 14:55:55 -0000 Message-ID: <20000328145555.60881.qmail@h...> X-Originating-IP: [194.202.149.139] From: "Adam S" To: References: Date: Tue, 28 Mar 2000 15:50:55 +0100 X-Priority: 3 X-MSMail-Priority: Normal X-Mailer: Microsoft Outlook Express 5.50.3825.400 X-MimeOLE: Produced By Microsoft MimeOLE V5.50.3825.400 Mailing-List: contact genomic-owner@egroups.com X-Mailing-List: genomic@egroups.com Precedence: bulk List-Help: , List-Unsubscribe: List-Archive: Reply-To: genomic@egroups.com Subject: [genomic] Re: Further proposal commentary MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_000C_01BF98CD.6743AFB0" Content-Transfer-Encoding: 7bit ------=_NextPart_000_000C_01BF98CD.6743AFB0 Content-Type: text/plain; charset="iso-8859-1" content-transfer-encoding: quoted-printable *laughs* that's the LAST TIEM I ask any rhetorical questions on this list :) > Do we have any common sense on the list, tho? :) I would venture to say yes, well into the plural even. However, science is the right way, so we'll take a poll: ******************************************************************* COMMON SENSES ON THE LIST (OR AMONG THOSE ON THE LIST, RATHER [OR CONTRIBUTING TO THE LIST, RATHER {AS WELL AS, COME TO THINK OF IT, THOSE NOT CONTRIBUTING, AS OF YET, BUT STILL INVOLVED IMPLICITLY BY HAVING JOINED THE GAME}]). {check all that apply} I have the capactity to: [X] See; [X] Hear; [X] Smell; [X] Taste; [X] Feel, in the sense of tactile stimulation; [ ] Feel, in the sense of getting teary when the old hound dog in "Lady and the Tramp" gets hit by that damned car and you think maybe he won't make it, but it's a Disney flick so of course he does; [X] Really, though, aren't "Smell" and "Taste" practically the same thing? I mean, yes, yes, you taste with your tongue and smell with your nose (or I do, anyhow), but without one the other is something between pointless and nonexistant. Arg, I do hope I'm not getting a cold; [X] Poor taste in lovers; (Sorry Hunter, *grins*, but at least one's (my) taste has improved of late!= :)))) [X] 75 cents American, enough to buy me a Pepsi; [X] ESP. I KNEW you were going to ask that. er, "I have the capacity to poor taste in lovers" and "I have the capacity = 75 cents American.." Doesn't make much sense *lol*, but I'm sure I catch your drift. ------=_NextPart_000_000C_01BF98CD.6743AFB0 Content-Type: text/html; charset="iso-8859-1" content-transfer-encoding: quoted-printable
*laughs*
that's the LAST TIEM I ask any rhetorical questions o= n this = list :)
> Do we have any common sense =
on the list, tho? :)

I would venture to say yes, well into the plural even. However, science
is the right way, so we'll take a poll:

*******************************************************************

COMMON SENSES ON THE LIST
(OR AMONG THOSE ON THE LIST, RATHER
[OR CONTRIBUTING TO THE LIST, RATHER
{AS WELL AS, COME TO THINK OF IT, THOSE NOT CONTRIBUTING, AS OF YET, BUT
STILL INVOLVED IMPLICITLY BY HAVING JOINED THE GAME}]).

{check all that apply}
I have the capactity to:

[X] See;
[X] Hear;
[X] Smell;
[X] Taste;
[X] Feel, in the sense of tactile stimulation;
[ ] Feel, in the sense of getting teary when the old hound dog in
"Lady and the Tramp" gets hit by that damned car and you
think maybe he won't make it, but it's a Disney flick so of
course he does;
[X] Really, though, aren't "Smell" and "Taste" practically the same
thing? I mean, yes, yes, you taste with your tongue and smell
with your nose (or I do, anyhow), but without one the other
is something between pointless and nonexistant. Arg, I do hope
I'm not getting a cold;
[X] Poor taste in lovers;
(Sorry Hunter, *grins*, but at least on=
e's (my) taste has improved of late! :))))
[X] 75 cents American, enough to buy me a Pepsi;
[X] ESP.
 
I KNEW you were going to ask that.
er, "I have the capacity to poor taste in lovers" and "I have the cap=
acity 75 cents American.."
Doesn't make much sense *lol*, but I'm=
sure I catch your drift.
 
 




------=_NextPart_000_000C_01BF98CD.6743AFB0--

From RavenBlack  Tue Mar 28 09:19:33 2000
Delivered-To: listsaver-of-genomic@egroups.com
Received: (listserv 315); by a2; 28 Mar 2000 17:19:52 -0000
Delivered-To: listsaver-egroups-genomic@egroups.com
Received: (qmail 19840 invoked from network); 28 Mar 2000 17:19:49 -0000
Received: from smtp03.mrf.mail.rcn.net (207.172.4.62) by mx3.egroups.com with SMTP; 28 Mar 2000 17:19:49 -0000
Received: from raven.alder.erols.com ([208.58.154.121] helo=roost) by smtp03.mrf.mail.rcn.net with smtp (Exim 2.12 #3) id 12Zzee-00038A-00 for genomic@egroups.com; Tue, 28 Mar 2000 12:19:49 -0500
Message-Id: <3.0.2.32.20000328121926.030105cc@w...>
X-Sender: raven@w...
X-Mailer: QUALCOMM Windows Eudora Light Version 3.0.2 (32)
Date: Tue, 28 Mar 2000 12:19:26 -0500
To: genomic@egroups.com
From: RavenBlack 
In-Reply-To: 
References: <20000328142725.44994.qmail@h...>
Mailing-List: contact genomic-owner@egroups.com
X-Mailing-List: genomic@egroups.com
Precedence: bulk
List-Help: ,
  
List-Unsubscribe: 
List-Archive: 
Reply-To: genomic@egroups.com
Subject: [genomic] Re: Further proposal commentary
MIME-Version: 1.0
Content-Type: text/plain; charset="us-ascii"
Content-Transfer-Encoding: 7bit

>[X] ESP. - you know the rest.

>Special Agent Pulp, Ph.D., M.D., OBGYN, STOP SEND MONEY STOP 
Don't you mean
"STOP, SEND MONEY, KEEP SENDING"?

--RavenBlack


From Pulp  Tue Mar 28 09:48:07 2000
Delivered-To: listsaver-of-genomic@egroups.com
Received: (listserv 315); by a2; 28 Mar 2000 17:48:26 -0000
Delivered-To: listsaver-egroups-genomic@egroups.com
Received: (qmail 8905 invoked from network); 28 Mar 2000 17:48:24 -0000
Received: from smtp.wpi.edu (130.215.24.62) by mx3.egroups.com with SMTP; 28 Mar 2000 17:48:24 -0000
Received: from wpi.WPI.EDU (root@w... [130.215.24.6]) by smtp.WPI.EDU (8.10.1.Beta1/8.10.1.Beta1) with ESMTP id e2SHmNh30756 for ; Tue, 28 Mar 2000 12:48:23 -0500 (EST)
Received: from localhost (pulp@l... [127.0.0.1]) by wpi.WPI.EDU (8.10.1.Beta1/8.10.1.Beta1) with ESMTP id e2SHmMt31377 for ; Tue, 28 Mar 2000 12:48:23 -0500 (EST)
Date: Tue, 28 Mar 2000 12:48:22 -0500 (EST)
From: Pulp 
To: genomic@egroups.com
In-Reply-To: <3.0.2.32.20000328121926.030105cc@w...>
Message-ID: 
Mailing-List: contact genomic-owner@egroups.com
X-Mailing-List: genomic@egroups.com
Precedence: bulk
List-Help: ,
  
List-Unsubscribe: 
List-Archive: 
Reply-To: genomic@egroups.com
Subject: [genomic] Re: Further proposal commentary
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit

> >[X] ESP. - you know the rest.

Ha!

> >Special Agent Pulp, Ph.D., M.D., OBGYN, STOP SEND MONEY STOP 
> Don't you mean
> "STOP, SEND MONEY, KEEP SENDING"?

Hmm. How about this:

10 SEND(MONEY)
20 GOTO 10
30 STOP

Pulp,
who has to wonder if the fact that BASIC is completely readable by just
about everyone is an argument for or against it.

Joshua Millard == p